Transcript: Human NR_130118.2

Homo sapiens TSC22 domain family member 4 (TSC22D4), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
TSC22D4 (81628)
Length:
1473
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130118.2
NBCI Gene record:
TSC22D4 (81628)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130118.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420004 GTGAAGTCCCACCTCATGTTT pLKO_005 830 3UTR 100% 5.625 3.938 N TSC22D4 n/a
2 TRCN0000018128 CCGGAGGAAAGCTGTAGACAT pLKO.1 544 3UTR 100% 4.950 3.465 N TSC22D4 n/a
3 TRCN0000086357 CCTGGTTGGCATTGACAACAA pLKO.1 787 3UTR 100% 4.950 3.465 N Tsc22d4 n/a
4 TRCN0000416275 GAGTTCAAGGCTCAGTAATGG pLKO_005 1137 3UTR 100% 4.950 3.465 N TSC22D4 n/a
5 TRCN0000018131 CCTGGTTCACAAATCTCCAGA pLKO.1 667 3UTR 100% 2.640 1.848 N TSC22D4 n/a
6 TRCN0000018130 CGGAGCAGTAGCAGCTCAGAA pLKO.1 694 3UTR 100% 1.650 1.155 N TSC22D4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130118.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16011 pDONR223 0% 52.3% None (many diffs) n/a
2 TRCN0000470943 CCCGACATCTAGCCTCCTAAAGAT pLX_317 42% 52.3% V5 (many diffs) n/a
3 ccsbBroadEn_16012 pDONR223 0% 52.3% None (many diffs) n/a
4 ccsbBroad304_16012 pLX_304 0% 52.3% V5 (many diffs) n/a
5 TRCN0000471474 CTGAAGCACGCGATAGCGACTGAG pLX_317 40.9% 52.3% V5 (many diffs) n/a
6 ccsbBroadEn_04251 pDONR223 100% 52.2% None (many diffs) n/a
7 ccsbBroad304_04251 pLX_304 0% 52.2% V5 (many diffs) n/a
8 TRCN0000467188 TTTAGCGAGAGCCCCCGCGACACC pLX_317 36.3% 52.2% V5 (many diffs) n/a
Download CSV