Transcript: Human NR_132350.1

Homo sapiens biogenesis of lysosomal organelles complex 1 subunit 6 (BLOC1S6), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
BLOC1S6 (26258)
Length:
4068
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_132350.1
NBCI Gene record:
BLOC1S6 (26258)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_132350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144654 GCAGACAATGTCACCTAAATT pLKO.1 2708 3UTR 100% 15.000 21.000 N BLOC1S6 n/a
2 TRCN0000379431 GAAATCCTTATTCCGGTATTA pLKO_005 954 3UTR 100% 13.200 18.480 N BLOC1S6 n/a
3 TRCN0000122781 GCAACGAGAGAAGGAGTTTGA pLKO.1 785 3UTR 100% 4.950 6.930 N BLOC1S6 n/a
4 TRCN0000380351 AGGATTGCTTTCTCATTATTT pLKO_005 317 3UTR 100% 15.000 10.500 N BLOC1S6 n/a
5 TRCN0000380916 GACTTGCCTTTCTGGTAATAC pLKO_005 1219 3UTR 100% 13.200 9.240 N BLOC1S6 n/a
6 TRCN0000381280 GGTAGTGCCTTATGCCATTAT pLKO_005 923 3UTR 100% 13.200 9.240 N BLOC1S6 n/a
7 TRCN0000382388 ACGAGAGAAGGAGTTTGAAAG pLKO_005 788 3UTR 100% 10.800 7.560 N BLOC1S6 n/a
8 TRCN0000380601 ACTTGACTATAGAAGACAAAG pLKO_005 277 3UTR 100% 10.800 7.560 N BLOC1S6 n/a
9 TRCN0000139294 CCCAGTAGACAGGCAATAGAT pLKO.1 3243 3UTR 100% 5.625 3.938 N BLOC1S6 n/a
10 TRCN0000144055 CAGAAGGATTGCTTTCTCATT pLKO.1 313 3UTR 100% 4.950 3.465 N BLOC1S6 n/a
11 TRCN0000143208 GACACACTGGAACAAGAGATT pLKO.1 576 3UTR 100% 4.950 3.465 N BLOC1S6 n/a
12 TRCN0000139331 CCGGTATTACTGTGTCTCCAT pLKO.1 966 3UTR 100% 2.640 1.848 N BLOC1S6 n/a
13 TRCN0000160626 CGTCTCTACTAGAAATACAAA pLKO.1 1935 3UTR 100% 5.625 2.813 Y TSNAX n/a
14 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2010 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_132350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02941 pDONR223 100% 12.3% None (many diffs) n/a
2 ccsbBroad304_02941 pLX_304 0% 12.3% V5 (many diffs) n/a
3 TRCN0000470905 ACGAGGCCTTTGGGCACCGACTAA pLX_317 75% 12.3% V5 (many diffs) n/a
Download CSV