Transcript: Human NR_133921.2

Homo sapiens frizzled class receptor 6 (FZD6), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
FZD6 (8323)
Length:
3646
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_133921.2
NBCI Gene record:
FZD6 (8323)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_133921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357045 ACCCAGAGAGACCAATTATAT pLKO_005 1003 3UTR 100% 15.000 10.500 N FZD6 n/a
2 TRCN0000008338 CCACCCATTGATTGTATTATA pLKO.1 3132 3UTR 100% 15.000 10.500 N FZD6 n/a
3 TRCN0000363512 TTAGTCCAAAGAGTGATATTA pLKO_005 2123 3UTR 100% 15.000 10.500 N FZD6 n/a
4 TRCN0000008340 CCCTAATCTGATGGGTCATTA pLKO.1 443 3UTR 100% 13.200 9.240 N FZD6 n/a
5 TRCN0000008342 CCTGGCACAGAGCAACAATTT pLKO.1 2154 3UTR 100% 13.200 9.240 N FZD6 n/a
6 TRCN0000008341 CGGCTTGTATCTTGTGCCATT pLKO.1 1580 3UTR 100% 4.050 2.835 N FZD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_133921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07221 pDONR223 100% 51.7% None (many diffs) n/a
2 ccsbBroad304_07221 pLX_304 0% 51.7% V5 (many diffs) n/a
3 TRCN0000488443 ACCCTAATCCATCCATGCTTCATA pLX_317 16.6% 51.7% V5 (many diffs) n/a
4 TRCN0000487944 AAATGTCACGCTGACTGCTTTATC pLX_317 16.8% 51.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV