Transcript: Human NR_134518.2

Homo sapiens membrane palmitoylated protein 7 (MPP7), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MPP7 (143098)
Length:
5223
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134518.2
NBCI Gene record:
MPP7 (143098)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148410 CCATCAATAGAGCGTTTGAGA pLKO.1 1885 3UTR 100% 3.000 4.200 N MPP7 n/a
2 TRCN0000278933 CCATCAATAGAGCGTTTGAGA pLKO_005 1885 3UTR 100% 3.000 4.200 N MPP7 n/a
3 TRCN0000148210 GCTGAATGAACTGAAACGAAA pLKO.1 1356 3UTR 100% 4.950 3.960 N MPP7 n/a
4 TRCN0000297581 GCTGAATGAACTGAAACGAAA pLKO_005 1356 3UTR 100% 4.950 3.960 N MPP7 n/a
5 TRCN0000278934 ACCACTGGGAGCTACCATTAA pLKO_005 657 3UTR 100% 13.200 9.240 N MPP7 n/a
6 TRCN0000278935 ACTACTACGGCACAAGTATAG pLKO_005 1544 3UTR 100% 10.800 7.560 N MPP7 n/a
7 TRCN0000382351 GCCAGTGAGCTGGTTACATTC pLKO_005 2127 3UTR 100% 10.800 7.560 N MPP7 n/a
8 TRCN0000150094 CAAGCCATTAAACAGTGAGAT pLKO.1 471 3UTR 100% 4.950 3.465 N MPP7 n/a
9 TRCN0000220690 GCACAGATAATGGAAAGTCAA pLKO.1 2002 3UTR 100% 4.950 3.465 N Mpp7 n/a
10 TRCN0000278866 TAGCTGTTGAAGGTATCAATT pLKO_005 2525 3UTR 100% 13.200 7.920 N MPP7 n/a
11 TRCN0000182915 CCTGAGGAAATAATACAGATT pLKO.1 808 3UTR 100% 4.950 2.970 N MPP7 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4404 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4404 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09602 pDONR223 100% 31.7% None (many diffs) n/a
2 ccsbBroad304_09602 pLX_304 0% 31.7% V5 (many diffs) n/a
3 ccsbBroadEn_15255 pDONR223 87.3% 31.7% None (many diffs) n/a
4 ccsbBroad304_15255 pLX_304 0% 31.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000469992 TACTATCCTTGAGGTCGAGTTTCT pLX_317 23.6% 31.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV