Transcript: Human NR_135089.1

Homo sapiens glomulin, FKBP associated protein (GLMN), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-04-02
Taxon:
Homo sapiens (human)
Gene:
GLMN (11146)
Length:
1957
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135089.1
NBCI Gene record:
GLMN (11146)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006579 GTCCTGTTGTTCGATGCCTTT pLKO.1 315 3UTR 100% 4.050 3.240 N GLMN n/a
2 TRCN0000352696 GTCCTGTTGTTCGATGCCTTT pLKO_005 315 3UTR 100% 4.050 3.240 N GLMN n/a
3 TRCN0000011034 CCCTTTGCTGACAGCACAATT pLKO.1 769 3UTR 100% 13.200 9.240 N GLMN n/a
4 TRCN0000337525 CCCTTTGCTGACAGCACAATT pLKO_005 769 3UTR 100% 13.200 9.240 N Glmn n/a
5 TRCN0000342547 CCCTTTGCTGACAGCACAATT pLKO_005 769 3UTR 100% 13.200 9.240 N GLMN n/a
6 TRCN0000006580 GATAGGATTATGGCTTCATTA pLKO.1 1435 3UTR 100% 13.200 9.240 N GLMN n/a
7 TRCN0000342535 GATAGGATTATGGCTTCATTA pLKO_005 1435 3UTR 100% 13.200 9.240 N GLMN n/a
8 TRCN0000012863 GCCACTTCATATAGGACTTAA pLKO.1 1551 3UTR 100% 13.200 9.240 N Glmn n/a
9 TRCN0000006578 GCCTCCTGAAATGCAGCTTAA pLKO.1 1677 3UTR 100% 10.800 7.560 N GLMN n/a
10 TRCN0000342546 GCCTCCTGAAATGCAGCTTAA pLKO_005 1677 3UTR 100% 10.800 7.560 N GLMN n/a
11 TRCN0000006581 GAAACTTCATAACAAGGCATA pLKO.1 517 3UTR 100% 4.050 2.835 N GLMN n/a
12 TRCN0000342534 GAAACTTCATAACAAGGCATA pLKO_005 517 3UTR 100% 4.050 2.835 N GLMN n/a
13 TRCN0000012865 GCACATTATGAAGCAGAAATT pLKO.1 1582 3UTR 100% 13.200 7.920 N Glmn n/a
14 TRCN0000337529 GCACATTATGAAGCAGAAATT pLKO_005 1582 3UTR 100% 13.200 7.920 N Glmn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135089.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02629 pDONR223 100% 83.1% None 1_115del;1327_1328ins85;1813_1957del n/a
2 ccsbBroad304_02629 pLX_304 0% 83.1% V5 1_115del;1327_1328ins85;1813_1957del n/a
3 TRCN0000478105 CCCAGTGCAAACAATACCGTTGCG pLX_317 21.8% 83.1% V5 1_115del;1327_1328ins85;1813_1957del n/a
Download CSV