Transcript: Human NR_135120.1

Homo sapiens mago homolog B, exon junction complex subunit (MAGOHB), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-05-11
Taxon:
Homo sapiens (human)
Gene:
MAGOHB (55110)
Length:
2895
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135120.1
NBCI Gene record:
MAGOHB (55110)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072324 CCGGACGGAAAGCTTAGATAT pLKO.1 165 3UTR 100% 13.200 18.480 N MAGOHB n/a
2 TRCN0000424847 GATACTTTAGGTGGAACTATG pLKO_005 1171 3UTR 100% 10.800 15.120 N MAGOHB n/a
3 TRCN0000434519 CTATGTCTCTAATTCACTTTA pLKO_005 1106 3UTR 100% 13.200 9.240 N MAGOHB n/a
4 TRCN0000072327 GAGTTTCTGGAGTTCGAATTT pLKO.1 141 3UTR 100% 13.200 9.240 N MAGOHB n/a
5 TRCN0000417493 ATTGATGTAAATCAGTCAAAG pLKO_005 691 3UTR 100% 10.800 7.560 N MAGOHB n/a
6 TRCN0000419872 CCAGATTCCCATCCATGAAAG pLKO_005 1195 3UTR 100% 10.800 7.560 N MAGOHB n/a
7 TRCN0000072323 CCTTCATACATGATTGGATTT pLKO.1 1240 3UTR 100% 10.800 7.560 N MAGOHB n/a
8 TRCN0000072326 TGGTACAAGACTTGAAATGTT pLKO.1 743 3UTR 100% 5.625 3.938 N MAGOHB n/a
9 TRCN0000072325 GTAATTGGAGATGAGCACATA pLKO.1 640 3UTR 100% 4.950 3.465 N MAGOHB n/a
10 TRCN0000174953 GATGTAAATCAGTCAAAGGAT pLKO.1 694 3UTR 100% 3.000 2.100 N Magohb n/a
11 TRCN0000353317 GATGTAAATCAGTCAAAGGAT pLKO_005 694 3UTR 100% 3.000 2.100 N Magohb n/a
12 TRCN0000215508 GAAGAACTGAAGAGAATTATT pLKO.1 255 3UTR 100% 15.000 9.000 N Magohb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00970 pDONR223 100% 13% None (many diffs) n/a
2 ccsbBroad304_00970 pLX_304 0% 13% V5 (many diffs) n/a
3 TRCN0000472892 GCGCCTCGAAAGTTGTCGTGATGT pLX_317 100% 13% V5 (many diffs) n/a
Download CSV