Transcript: Human NR_135855.2

Homo sapiens thyroid hormone receptor interactor 4 (TRIP4), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TRIP4 (9325)
Length:
1886
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135855.2
NBCI Gene record:
TRIP4 (9325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135855.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022136 CAGGCTACATATCGTCTTCTT pLKO.1 1354 3UTR 100% 4.950 6.930 N TRIP4 n/a
2 TRCN0000022137 CGGAAGACTTTCGGCCTGGAT pLKO.1 89 3UTR 100% 0.880 0.704 N TRIP4 n/a
3 TRCN0000285344 CTGGGCTGTGTGGACCTAATT pLKO_005 1423 3UTR 100% 13.200 9.240 N TRIP4 n/a
4 TRCN0000275292 GAAATCAGGCGACCATCTAAA pLKO_005 316 3UTR 100% 13.200 9.240 N TRIP4 n/a
5 TRCN0000275338 GGACTAGAGTTCAACTCATTT pLKO_005 1129 3UTR 100% 13.200 9.240 N TRIP4 n/a
6 TRCN0000275339 TGGAATTGAAGTAGTAGAAAC pLKO_005 1716 3UTR 100% 10.800 7.560 N TRIP4 n/a
7 TRCN0000022134 CCTCATCAAGAATTGCGAATT pLKO.1 773 3UTR 100% 0.000 0.000 N TRIP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135855.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07388 pDONR223 100% 80.1% None (many diffs) n/a
2 ccsbBroad304_07388 pLX_304 0% 80.1% V5 (many diffs) n/a
3 TRCN0000480651 TCTCTGACGTCAGCACCCCTAAAA pLX_317 23.9% 80.1% V5 (many diffs) n/a
Download CSV