Transcript: Human NR_137437.1

Homo sapiens BRISC and BRCA1 A complex member 2 (BABAM2), transcript variant 11, non-coding RNA.

Source:
NCBI, updated 2019-03-25
Taxon:
Homo sapiens (human)
Gene:
BABAM2 (9577)
Length:
1709
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_137437.1
NBCI Gene record:
BABAM2 (9577)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_137437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221082 GCCCGTAGATTTCAGCAATAT pLKO.1 783 3UTR 100% 13.200 18.480 N BABAM2 n/a
2 TRCN0000221085 GCTGTACTTGTCACCTCGAAT pLKO.1 906 3UTR 100% 4.950 6.930 N BABAM2 n/a
3 TRCN0000221086 GCCTCCTGGAATCCTTCAAAT pLKO.1 559 3UTR 100% 13.200 9.240 N BABAM2 n/a
4 TRCN0000246487 GTGGGACTGGATGCTACAAAC pLKO_005 331 3UTR 100% 10.800 7.560 N Babam2 n/a
5 TRCN0000221084 CCCTCAGCTTTGCAGAATCTT pLKO.1 538 3UTR 100% 5.625 3.375 N BABAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_137437.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02202 pDONR223 100% 59.4% None 1_252del;1103_1104ins83;1319_1709del n/a
2 ccsbBroad304_02202 pLX_304 0% 59.4% V5 (not translated due to frame shift) 1_252del;1103_1104ins83;1319_1709del n/a
3 TRCN0000467617 CATCATGGTCCGACTACATGCCCG pLX_317 7.3% 59.4% V5 (not translated due to prior stop codon) 1_252del;1103_1104ins83;1319_1709del n/a
Download CSV