Construct: ORF TRCN0000467617
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012139.1_s317c1
- Derived from:
- ccsbBroadEn_02202
- DNA Barcode:
- CATCATGGTCCGACTACATGCCCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BABAM2 (9577)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467617
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NM_001329112.1 | 100% | 100% | |
| 2 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NM_199191.2 | 100% | 100% | |
| 3 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NM_199194.2 | 100% | 100% | |
| 4 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NM_001261840.2 | 96.2% | 94.7% | 1088_1089ins28;1122_1137del |
| 5 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NM_199192.2 | 95.2% | 95% | (many diffs) |
| 6 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NM_199193.2 | 95.2% | 95% | (many diffs) |
| 7 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NM_001329113.1 | 90.3% | 88.9% | (many diffs) |
| 8 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NM_004899.4 | 90.3% | 88.9% | (many diffs) |
| 9 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NM_001329115.1 | 87% | 86.8% | 1089_1259del |
| 10 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NM_001329114.1 | 78.2% | 74.2% | (many diffs) |
| 11 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NR_137437.1 | 59.4% | 1_252del;1103_1104ins83;1319_1709del | |
| 12 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NR_137439.1 | 56.3% | 1_252del;1341_1586del;1648_2038del | |
| 13 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NR_137438.1 | 55.2% | 1_252del;1341_1628del;1690_2080del | |
| 14 | human | 9577 | BABAM2 | BRISC and BRCA1 A complex m... | NR_137440.1 | 55.1% | 1_252del;1341_1632del;1694_2084del | |
| 15 | mouse | 107976 | Babam2 | BRISC and BRCA1 A complex m... | NM_144541.1 | 90.2% | 99.2% | (many diffs) |
| 16 | mouse | 107976 | Babam2 | BRISC and BRCA1 A complex m... | NM_181280.1 | 84.1% | 85% | (many diffs) |
| 17 | mouse | 107976 | Babam2 | BRISC and BRCA1 A complex m... | NM_181279.1 | 81.5% | 87.3% | (many diffs) |
| 18 | mouse | 107976 | Babam2 | BRISC and BRCA1 A complex m... | XM_011240687.3 | 75.6% | 82.5% | (many diffs) |
| 19 | mouse | 107976 | Babam2 | BRISC and BRCA1 A complex m... | NM_181281.1 | 75% | 81.4% | (many diffs) |
| 20 | mouse | 107976 | Babam2 | BRISC and BRCA1 A complex m... | NM_181282.1 | 59.1% | 63.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1215
- ORF length:
- 1149
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cccagaagtg gccttgaacc gaatatctcc aatgctctcc cctttcatat 121 ctagcgtggt ccggaatgga aaagtgggac tggatgctac aaactgtttg aggataactg 181 acttaaaatc tggctgcaca tcattgactc ctgggcccaa ctgtgaccga tttaaactgc 241 acataccata tgctggagag acattaaagt gggatatcat tttcaatgcc caatacccag 301 aactgcctcc cgattttatc tttggagaag atgctgaatt cctgccagac ccctcagctt 361 tgcagaatct tgcctcctgg aatccttcaa atcctgaatg tctcttactt gtggtgaagg 421 aacttgtgca acaatatcac caattccaat gtagccgcct ccgggagagc tcccgcctca 481 tgtttgaata ccagacatta ctggaggagc cacagtatgg agagaacatg gaaatttatg 541 ctgggaaaaa aaacaactgg actggtgaat tttcagctcg tttccttttg aagctgcccg 601 tagatttcag caatatcccc acataccttc tcaaggatgt aaatgaagac cctggagaag 661 atgtggccct cctctctgtt agttttgagg acactgaagc cacccaggtg taccccaagc 721 tgtacttgtc acctcgaatt gagcatgcac ttggaggctc ctcagctctt catatcccag 781 cttttccagg aggaggatgt ctcattgatt acgttcctca agtatgccac ctgctcacca 841 acaaggtgca gtacgtgatt caagggtatc acaaaagaag agagtatatt gctgcttttc 901 tcagtcactt tggcacaggt gtcgtggaat atgatgcaga aggctttaca aaactcactc 961 tgctgctgat gtggaaagat ttttgttttc ttgtacacat tgacctgcct ctgtttttcc 1021 ctcgagacca gccaactctc acatttcagt ccgtttatca ctttaccaac agtggacagc 1081 tttactccca ggcccaaaaa aattatccgt acagccccag atgggatgga aatgaaatgg 1141 CCAAAAGAGC AAAGGCTTAT TTCAAAACCT TTGTCCCTCA GTTCCAGGAG GCAGCATTTG 1201 CCAATGGAAA GCTCTACCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC 1261 CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT 1321 ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG ACATCATGGT CCGACTACAT 1381 GCCCGACGCG TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt