Transcript: Human NR_138426.2

Homo sapiens NudC domain containing 2 (NUDCD2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NUDCD2 (134492)
Length:
8502
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_138426.2
NBCI Gene record:
NUDCD2 (134492)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_138426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155492 GAATCTGAATATGCAGCGGAT pLKO.1 900 3UTR 100% 2.160 3.024 N NUDCD2 n/a
2 TRCN0000430545 TGTGGATCCTAGCAGATATTG pLKO_005 1082 3UTR 100% 13.200 9.240 N NUDCD2 n/a
3 TRCN0000431279 ACTAAAGGTGGACCAGATTTC pLKO_005 1023 3UTR 100% 10.800 7.560 N NUDCD2 n/a
4 TRCN0000429927 GATGAGGGAACATGGACTTTG pLKO_005 804 3UTR 100% 10.800 7.560 N NUDCD2 n/a
5 TRCN0000435714 GTTCGTATTGTTCTTACAAAG pLKO_005 840 3UTR 100% 10.800 7.560 N NUDCD2 n/a
6 TRCN0000183535 GCAAACTCTTTGATTCTACAA pLKO.1 778 3UTR 100% 4.950 3.465 N NUDCD2 n/a
7 TRCN0000414243 GCAAATTGTTGGACTTCTCTA pLKO_005 876 3UTR 100% 4.950 3.465 N NUDCD2 n/a
8 TRCN0000201327 GCAAGACCAAATGCAGAGAAA pLKO.1 929 3UTR 100% 4.950 3.465 N Nudcd2 n/a
9 TRCN0000157671 GTGGAGCAGAAATCTCAGGAA pLKO.1 997 3UTR 100% 2.640 1.848 N NUDCD2 n/a
10 TRCN0000155178 GAGGAGGTGTTCATTGAAGTT pLKO.1 128 3UTR 100% 4.950 2.970 N NUDCD2 n/a
11 TRCN0000040213 CCTCCCAAATTGCTGGGATTA pLKO.1 3211 3UTR 100% 1.080 0.540 Y IGF1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8253 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 3021 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
14 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4874 3UTR 100% 2.640 1.320 Y LINC01098 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8253 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_138426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04893 pDONR223 100% 5.5% None 1_52del;240_774del;1059_8502del n/a
2 ccsbBroad304_04893 pLX_304 0% 5.5% V5 1_52del;240_774del;1059_8502del n/a
3 ccsbBroadEn_10261 pDONR223 100% .7% None (many diffs) n/a
4 ccsbBroad304_10261 pLX_304 0% .7% V5 (many diffs) n/a
5 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .7% V5 (many diffs) n/a
Download CSV