Transcript: Human NR_138486.2

Homo sapiens insulin like growth factor 2 mRNA binding protein 2 (IGF2BP2), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
IGF2BP2 (10644)
Length:
3400
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_138486.2
NBCI Gene record:
IGF2BP2 (10644)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_138486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255468 GTTGGCCCAGGGCGTTAAATT pLKO_005 2245 3UTR 100% 15.000 21.000 N IGF2BP2 n/a
2 TRCN0000265644 GCCGTTGTCAACGTCACATAT pLKO_005 443 3UTR 100% 13.200 18.480 N IGF2BP2 n/a
3 TRCN0000255460 ATCGAGACCCTCTCGGGTAAA pLKO_005 245 3UTR 100% 10.800 15.120 N IGF2BP2 n/a
4 TRCN0000148565 CGGATCTTTGGGAAACTGAAA pLKO.1 1424 3UTR 100% 4.950 3.960 N IGF2BP2 n/a
5 TRCN0000255461 AGCGCAAGATCAGGGAAATTG pLKO_005 1668 3UTR 100% 13.200 9.240 N IGF2BP2 n/a
6 TRCN0000146301 CAGTGCTGAGATAGAGATTAT pLKO.1 1087 3UTR 100% 13.200 9.240 N IGF2BP2 n/a
7 TRCN0000255466 TCAGGCCAGACAGATTGATTT pLKO_005 643 3UTR 100% 13.200 9.240 N IGF2BP2 n/a
8 TRCN0000255467 TTCCCGCATCATCACTCTTAT pLKO_005 1205 3UTR 100% 13.200 9.240 N IGF2BP2 n/a
9 TRCN0000255462 AGTGAAGCTGGAAGCGCATAT pLKO_005 1474 3UTR 100% 10.800 7.560 N IGF2BP2 n/a
10 TRCN0000255465 ATCAAACAGCTGGCGAGATTC pLKO_005 1301 3UTR 100% 10.800 7.560 N IGF2BP2 n/a
11 TRCN0000255464 CTGAAGCATGCCGCATGATTC pLKO_005 837 3UTR 100% 10.800 7.560 N IGF2BP2 n/a
12 TRCN0000149002 GCATATACAACCCGGAAAGAA pLKO.1 1032 3UTR 100% 5.625 3.938 N IGF2BP2 n/a
13 TRCN0000148718 CTTAACCAGTGCAGAAGTCAT pLKO.1 1564 3UTR 100% 4.950 3.465 N IGF2BP2 n/a
14 TRCN0000096763 CCTCTCGGGTAAAGTGGAATT pLKO.1 253 3UTR 100% 0.000 0.000 N Igf2bp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_138486.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10208 pDONR223 100% 47.1% None 1_85del;1153_1154ins129;1751_3400del n/a
2 ccsbBroad304_10208 pLX_304 0% 47.1% V5 1_85del;1153_1154ins129;1751_3400del n/a
3 TRCN0000469479 CACTGCACGGTTCACGCTGAGAAA pLX_317 22.8% 47.1% V5 1_85del;1153_1154ins129;1751_3400del n/a
Download CSV