Transcript: Human NR_144382.1

Homo sapiens chromosome 12 open reading frame 4 (C12orf4), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
C12orf4 (57102)
Length:
3224
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144382.1
NBCI Gene record:
C12orf4 (57102)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134101 CCCATGACATCACAACAATAA pLKO.1 873 3UTR 100% 13.200 9.240 N C12orf4 n/a
2 TRCN0000134537 GCTCATCAACATTGTGACAAT pLKO.1 1879 3UTR 100% 4.950 3.465 N C12orf4 n/a
3 TRCN0000138019 GCTGGGAATCTGTCAAGCAAA pLKO.1 1210 3UTR 100% 4.950 3.465 N C12orf4 n/a
4 TRCN0000137468 GCTGTGAAATCAGGTGAAGTA pLKO.1 181 3UTR 100% 4.950 3.465 N C12orf4 n/a
5 TRCN0000133910 CAAGAGTATCAAGAATGGGTA pLKO.1 583 3UTR 100% 2.640 1.848 N C12orf4 n/a
6 TRCN0000133994 CGATTATGATAGAGATGCTGA pLKO.1 147 3UTR 100% 2.640 1.848 N C12orf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03781 pDONR223 100% 29.4% None (many diffs) n/a
2 ccsbBroad304_03781 pLX_304 0% 29.4% V5 (many diffs) n/a
3 TRCN0000474427 CCCATCTACTAGCATTGGGAGGTT pLX_317 19.2% 29.4% V5 (many diffs) n/a
Download CSV