Transcript: Human NR_144949.2

Homo sapiens intraflagellar transport 81 (IFT81), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
IFT81 (28981)
Length:
3156
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144949.2
NBCI Gene record:
IFT81 (28981)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144949.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159456 GCATCTATCATTTCCCGTAAA pLKO.1 1600 3UTR 100% 10.800 15.120 N IFT81 n/a
2 TRCN0000319322 GCATCTATCATTTCCCGTAAA pLKO_005 1600 3UTR 100% 10.800 15.120 N IFT81 n/a
3 TRCN0000160682 CAAGGCAACTTCGAGTTGAAA pLKO.1 1062 3UTR 100% 5.625 4.500 N IFT81 n/a
4 TRCN0000160264 CAGCTCATTAAGAGAGTTGAA pLKO.1 986 3UTR 100% 4.950 3.960 N IFT81 n/a
5 TRCN0000159740 GCCCTTTAGGAAGAACTATAA pLKO.1 571 3UTR 100% 13.200 9.240 N IFT81 n/a
6 TRCN0000319320 GCCCTTTAGGAAGAACTATAA pLKO_005 571 3UTR 100% 13.200 9.240 N IFT81 n/a
7 TRCN0000158908 CTCTTGTTCTGAAGAAACATT pLKO.1 2981 3UTR 100% 5.625 3.938 N IFT81 n/a
8 TRCN0000349715 CTCTTGTTCTGAAGAAACATT pLKO_005 2981 3UTR 100% 5.625 3.938 N IFT81 n/a
9 TRCN0000159127 GACAGGAAACTAAGTTTACTA pLKO.1 2831 3UTR 100% 5.625 3.938 N IFT81 n/a
10 TRCN0000319323 GACAGGAAACTAAGTTTACTA pLKO_005 2831 3UTR 100% 5.625 3.938 N IFT81 n/a
11 TRCN0000163327 CGTTCAGCAGTTCCTACAGTT pLKO.1 3009 3UTR 100% 4.950 3.465 N IFT81 n/a
12 TRCN0000192134 GCACAACAGAAACAGGAACAA pLKO.1 1103 3UTR 100% 4.950 3.465 N Ift81 n/a
13 TRCN0000163554 GCTGAGATTGACCCAAAGCAA pLKO.1 653 3UTR 100% 3.000 2.100 N IFT81 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144949.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03054 pDONR223 100% 35.5% None (many diffs) n/a
2 ccsbBroad304_03054 pLX_304 0% 35.5% V5 (many diffs) n/a
3 TRCN0000480355 CTTCTCTTCATGCTTACGGGAGCT pLX_317 29% 35.5% V5 (many diffs) n/a
4 ccsbBroadEn_15801 pDONR223 0% 10.1% None 1_2265del;2587_3156del n/a
5 ccsbBroad304_15801 pLX_304 0% 10.1% V5 1_2265del;2587_3156del n/a
Download CSV