Transcript: Human NR_145410.1

Homo sapiens abl interactor 1 (ABI1), transcript variant 19, non-coding RNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ABI1 (10006)
Length:
3771
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145410.1
NBCI Gene record:
ABI1 (10006)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427455 CTAACGCTATGTCAGACTAAT pLKO_005 2144 3UTR 100% 13.200 18.480 N ABI1 n/a
2 TRCN0000424081 TATTCGGAAACCTATCGATTA pLKO_005 632 3UTR 100% 10.800 15.120 N ABI1 n/a
3 TRCN0000158272 CCACCACCAGTGGATTATGAA pLKO.1 1516 3UTR 100% 5.625 7.875 N ABI1 n/a
4 TRCN0000153304 GCCTATACAACCCAATCTCTA pLKO.1 378 3UTR 100% 4.950 6.930 N ABI1 n/a
5 TRCN0000417741 CACGAAGAGAGATTGGTATTT pLKO_005 538 3UTR 100% 13.200 9.240 N ABI1 n/a
6 TRCN0000158184 CCATGGTGTCAAGTGGCTAAA pLKO.1 674 3UTR 100% 10.800 7.560 N ABI1 n/a
7 TRCN0000150977 CCAACAGTTCCTAATGACTAT pLKO.1 843 3UTR 100% 4.950 3.465 N ABI1 n/a
8 TRCN0000157985 CCTCAGTTGACTCCACAGATA pLKO.1 1378 3UTR 100% 4.950 3.465 N ABI1 n/a
9 TRCN0000018497 TGTTGAATCAATCATGCACTA pLKO.1 1767 3UTR 100% 4.050 2.835 N Abi1 n/a
10 TRCN0000153710 CAGTAGTATTGGCATTCCCAT pLKO.1 986 3UTR 100% 2.640 1.848 N ABI1 n/a
11 TRCN0000018496 CGACATCTTCTGGTGGATATA pLKO.1 1250 3UTR 100% 13.200 18.480 N Abi1 n/a
12 TRCN0000321712 CGACATCTTCTGGTGGATATA pLKO_005 1250 3UTR 100% 13.200 18.480 N Abi1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14034 pDONR223 100% 37.8% None (many diffs) n/a
2 ccsbBroad304_14034 pLX_304 0% 37.8% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000481323 TCTTTGTGCACTTCCTTGTCAAAT pLX_317 29.3% 37.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV