Transcript: Human NR_146130.2

Homo sapiens F-box and leucine rich repeat protein 2 (FBXL2), transcript variant 21, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
FBXL2 (25827)
Length:
4085
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146130.2
NBCI Gene record:
FBXL2 (25827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146130.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279844 GCTCGGAATTGCCACGAATTG pLKO_005 1080 3UTR 100% 10.800 15.120 N FBXL2 n/a
2 TRCN0000004278 CTCTCCATTCACTGTCCTAAA pLKO.1 1155 3UTR 100% 10.800 7.560 N FBXL2 n/a
3 TRCN0000279842 CTCTCCATTCACTGTCCTAAA pLKO_005 1155 3UTR 100% 10.800 7.560 N FBXL2 n/a
4 TRCN0000004277 GATAACCGACAGCACACTCAT pLKO.1 1130 3UTR 100% 4.950 3.465 N FBXL2 n/a
5 TRCN0000004279 TGGCCTACTTTAATTCACAAT pLKO.1 2006 3UTR 100% 4.950 3.465 N FBXL2 n/a
6 TRCN0000279840 TGGCCTACTTTAATTCACAAT pLKO_005 2006 3UTR 100% 4.950 3.465 N FBXL2 n/a
7 TRCN0000092671 CCTTAGCAGATTCTGTTCCAA pLKO.1 608 3UTR 100% 3.000 2.100 N Fbxl2 n/a
8 TRCN0000004276 GAACCTCAATGGATGCACAAA pLKO.1 563 3UTR 100% 4.950 2.970 N FBXL2 n/a
9 TRCN0000279774 GAACCTCAATGGATGCACAAA pLKO_005 563 3UTR 100% 4.950 2.970 N FBXL2 n/a
10 TRCN0000004280 GTCTATTACAAACAGCTCCTT pLKO.1 659 3UTR 100% 2.640 1.584 N FBXL2 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3799 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 3854 3UTR 100% 4.050 2.025 Y INTS7 n/a
13 TRCN0000437561 ATCACTGACAGCACGTGTTAC pLKO_005 585 3UTR 100% 10.800 7.560 N Fbxl2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3800 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146130.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02865 pDONR223 100% 31% None (many diffs) n/a
2 ccsbBroad304_02865 pLX_304 0% 31% V5 (many diffs) n/a
3 TRCN0000480745 CATTCGACCGAATATATATCTGAC pLX_317 31.4% 31% V5 (many diffs) n/a
Download CSV