Transcript: Human NR_146132.2

Homo sapiens F-box and leucine rich repeat protein 2 (FBXL2), transcript variant 23, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
FBXL2 (25827)
Length:
2438
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146132.2
NBCI Gene record:
FBXL2 (25827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279844 GCTCGGAATTGCCACGAATTG pLKO_005 915 3UTR 100% 10.800 15.120 N FBXL2 n/a
2 TRCN0000004278 CTCTCCATTCACTGTCCTAAA pLKO.1 990 3UTR 100% 10.800 7.560 N FBXL2 n/a
3 TRCN0000279842 CTCTCCATTCACTGTCCTAAA pLKO_005 990 3UTR 100% 10.800 7.560 N FBXL2 n/a
4 TRCN0000004277 GATAACCGACAGCACACTCAT pLKO.1 965 3UTR 100% 4.950 3.465 N FBXL2 n/a
5 TRCN0000092671 CCTTAGCAGATTCTGTTCCAA pLKO.1 443 3UTR 100% 3.000 2.100 N Fbxl2 n/a
6 TRCN0000004276 GAACCTCAATGGATGCACAAA pLKO.1 398 3UTR 100% 4.950 2.970 N FBXL2 n/a
7 TRCN0000279774 GAACCTCAATGGATGCACAAA pLKO_005 398 3UTR 100% 4.950 2.970 N FBXL2 n/a
8 TRCN0000004280 GTCTATTACAAACAGCTCCTT pLKO.1 494 3UTR 100% 2.640 1.584 N FBXL2 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1526 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1526 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 2194 3UTR 100% 4.950 2.475 Y NPHS1 n/a
12 TRCN0000437561 ATCACTGACAGCACGTGTTAC pLKO_005 420 3UTR 100% 10.800 7.560 N Fbxl2 n/a
13 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1524 3UTR 100% 4.950 2.475 Y ERN2 n/a
14 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1524 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1524 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02865 pDONR223 100% 52% None 1_71del;1341_2438del n/a
2 ccsbBroad304_02865 pLX_304 0% 52% V5 1_71del;1341_2438del n/a
3 TRCN0000480745 CATTCGACCGAATATATATCTGAC pLX_317 31.4% 52% V5 1_71del;1341_2438del n/a
Download CSV