Transcript: Human NR_146394.1

Homo sapiens sorbitol dehydrogenase 2, pseudogene (SORD2P), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-04-06
Taxon:
Homo sapiens (human)
Gene:
SORD2P (653381)
Length:
2498
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146394.1
NBCI Gene record:
SORD2P (653381)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221399 GATCGTGTTGCCATCGAATCT pLKO.1 384 3UTR 100% 4.950 3.465 N SORDL n/a
2 TRCN0000028106 CGTCCAAGTCTGTGAATGTAA pLKO.1 1050 3UTR 100% 5.625 2.813 Y SORD n/a
3 TRCN0000292388 CGTCCAAGTCTGTGAATGTAA pLKO_005 1050 3UTR 100% 5.625 2.813 Y SORD n/a
4 TRCN0000221398 GCTCAAGTAGTGGTGACTGAT pLKO.1 708 3UTR 100% 4.950 2.475 Y SORDL n/a
5 TRCN0000028069 GAGAACTATCCTATCCCTGAA pLKO.1 183 3UTR 100% 4.050 2.025 Y SORD n/a
6 TRCN0000292389 GAGAACTATCCTATCCCTGAA pLKO_005 183 3UTR 100% 4.050 2.025 Y SORD n/a
7 TRCN0000028082 GCCGATACAATCTGTCACCTT pLKO.1 442 3UTR 100% 2.640 1.320 Y SORD n/a
8 TRCN0000292390 GCCGATACAATCTGTCACCTT pLKO_005 442 3UTR 100% 2.640 1.320 Y SORD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06985 pDONR223 100% 41.5% None (many diffs) n/a
2 ccsbBroad304_06985 pLX_304 0% 41.5% V5 (many diffs) n/a
3 TRCN0000468155 TTTTCCTCTAAATTGCCGAATAAT pLX_317 18.4% 41.5% V5 (many diffs) n/a
Download CSV