Transcript: Human NR_146796.1

Homo sapiens tRNA methyltransferase 11 homolog (TRMT11), transcript variant 21, non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
TRMT11 (60487)
Length:
2066
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146796.1
NBCI Gene record:
TRMT11 (60487)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276167 TCTATTGGTTACCGGTGTATA pLKO_005 1346 3UTR 100% 13.200 18.480 N TRMT11 n/a
2 TRCN0000276166 TGCCATACCAAGGTCATAATT pLKO_005 1535 3UTR 100% 15.000 10.500 N TRMT11 n/a
3 TRCN0000161645 GATGGACAGAGAGAGCTTATT pLKO.1 650 3UTR 100% 13.200 9.240 N TRMT11 n/a
4 TRCN0000161341 GCTGATAGCATGTGCTCATTT pLKO.1 921 3UTR 100% 13.200 9.240 N TRMT11 n/a
5 TRCN0000276098 GACATCTGGATGTGAACTTTC pLKO_005 1675 3UTR 100% 10.800 7.560 N TRMT11 n/a
6 TRCN0000159429 GCACTTGAATTTCTGCCATTT pLKO.1 509 3UTR 100% 10.800 7.560 N TRMT11 n/a
7 TRCN0000319401 GCACTTGAATTTCTGCCATTT pLKO_005 509 3UTR 100% 10.800 7.560 N TRMT11 n/a
8 TRCN0000158425 CCTGTTTCCTTGAGTTATCAT pLKO.1 1258 3UTR 100% 5.625 3.938 N TRMT11 n/a
9 TRCN0000276165 CCTGTTTCCTTGAGTTATCAT pLKO_005 1258 3UTR 100% 5.625 3.938 N TRMT11 n/a
10 TRCN0000166781 CCAAACTGCATCCCTGAGAAT pLKO.1 596 3UTR 100% 4.950 3.465 N TRMT11 n/a
11 TRCN0000159341 GAGAGAGCTTATTGAGTCATA pLKO.1 658 3UTR 100% 4.950 3.465 N TRMT11 n/a
12 TRCN0000160850 GCCGGAAATAAAGTCTTTGCT pLKO.1 190 3UTR 100% 3.000 2.100 N TRMT11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08794 pDONR223 100% 67.1% None (many diffs) n/a
2 ccsbBroad304_08794 pLX_304 0% 67.1% V5 (many diffs) n/a
3 TRCN0000478001 ACTTGACGTTACCGTTCGACTTCC pLX_317 20.3% 67.1% V5 (many diffs) n/a
Download CSV