Transcript: Human NR_148198.1

Homo sapiens SP140 nuclear body protein like (SP140L), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
SP140L (93349)
Length:
2551
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148198.1
NBCI Gene record:
SP140L (93349)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021959 GATCTCTACCTAATCCTCCAA pLKO.1 1031 3UTR 100% 2.640 2.112 N SP140L n/a
2 TRCN0000359335 ACCTAATCCTCCAAGAATATA pLKO_005 1038 3UTR 100% 15.000 10.500 N SP140L n/a
3 TRCN0000359269 CATAAGCTGGAGATATCAAAT pLKO_005 202 3UTR 100% 13.200 9.240 N SP140L n/a
4 TRCN0000359341 TGACATCAAACTAAGTCTTAA pLKO_005 522 3UTR 100% 13.200 9.240 N SP140L n/a
5 TRCN0000021962 CCTTGGCAAAGTGTATACAGA pLKO.1 887 3UTR 100% 3.000 2.100 N SP140L n/a
6 TRCN0000021963 TGGAGGAAGGATCTCTACCTA pLKO.1 1022 3UTR 100% 3.000 2.100 N SP140L n/a
7 TRCN0000021960 CGACACTTGTTCAAGAGTCTT pLKO.1 1173 3UTR 100% 4.950 2.475 Y SP140L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148198.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15487 pDONR223 0% 6.2% None (many diffs) n/a
2 ccsbBroad304_15487 pLX_304 0% 6.2% V5 (many diffs) n/a
3 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 6.2% V5 (many diffs) n/a
Download CSV