Transcript: Human NR_148950.2

Homo sapiens XPC complex subunit, DNA damage recognition and repair factor (XPC), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
XPC (7508)
Length:
3489
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148950.2
NBCI Gene record:
XPC (7508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296566 TGAGGAATTGGTCCATATATT pLKO_005 918 3UTR 100% 15.000 10.500 N XPC n/a
2 TRCN0000296565 ATGGAAGCCACCGGGAGATTT pLKO_005 3039 3UTR 100% 13.200 9.240 N XPC n/a
3 TRCN0000083118 CCAGTGGAGATAGAGATTGAA pLKO.1 517 3UTR 100% 5.625 3.938 N XPC n/a
4 TRCN0000083122 GCAACAGCAAAGGGAAAGAAA pLKO.1 1012 3UTR 100% 5.625 3.938 N XPC n/a
5 TRCN0000307193 GCAACAGCAAAGGGAAAGAAA pLKO_005 1012 3UTR 100% 5.625 3.938 N XPC n/a
6 TRCN0000083121 GCCTCTGACCTGTTACAAGTA pLKO.1 1695 3UTR 100% 4.950 3.465 N XPC n/a
7 TRCN0000290389 GCCTCTGACCTGTTACAAGTA pLKO_005 1695 3UTR 100% 4.950 3.465 N XPC n/a
8 TRCN0000083120 GCAGGCAGTCATTGAAAGGAA pLKO.1 2356 3UTR 100% 3.000 2.100 N XPC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148950.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07140 pDONR223 100% 72.7% None (many diffs) n/a
2 ccsbBroad304_07140 pLX_304 0% 72.7% V5 (many diffs) n/a
3 TRCN0000480030 GACGCCAACACATAATGATCTCAC pLX_317 12.5% 72.7% V5 (many diffs) n/a
Download CSV