Transcript: Human NR_149722.1

Homo sapiens family with sequence similarity 153 member C, pseudogene (FAM153CP), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-03-29
Taxon:
Homo sapiens (human)
Gene:
FAM153CP (653316)
Length:
2552
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_149722.1
NBCI Gene record:
FAM153CP (653316)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_149722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164978 GTGGTGGCTTATGCCTGTAAT pLKO.1 1151 3UTR 100% 13.200 6.600 Y C9orf139 n/a
2 TRCN0000269658 ACTACGGGAGCTCCACCTATA pLKO_005 609 3UTR 100% 10.800 5.400 Y FAM153CP n/a
3 TRCN0000281704 ATTGGAAGACTCCACCATTAC pLKO_005 792 3UTR 100% 10.800 5.400 Y FAM153CP n/a
4 TRCN0000269708 AGTACCAAGAGGCGATGAAGA pLKO_005 644 3UTR 100% 4.950 2.475 Y FAM153CP n/a
5 TRCN0000148967 GTCCTGAAATGTTGGGACATT pLKO.1 955 3UTR 100% 0.495 0.248 Y FAM153A n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 142 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_149722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13732 pDONR223 100% 16.9% None 1_555del;988_2552del n/a
2 ccsbBroad304_13732 pLX_304 0% 16.9% V5 1_555del;988_2552del n/a
3 TRCN0000492291 GCGTAGATGATAAGAAGTTGGTAC pLX_317 87.2% 16.9% V5 1_555del;988_2552del n/a
4 ccsbBroadEn_05725 pDONR223 100% 13.4% None 1_555del;898_2552del n/a
5 ccsbBroad304_05725 pLX_304 0% 13.4% V5 1_555del;898_2552del n/a
6 TRCN0000479395 GTAGGCACGAAATGGCCCTAATGA pLX_317 84.1% 13.4% V5 1_555del;898_2552del n/a
Download CSV