Transcript: Mouse NR_149726.1

Mus musculus F-box protein 3 (Fbxo3), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2018-05-26
Taxon:
Mus musculus (mouse)
Gene:
Fbxo3 (57443)
Length:
2687
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_149726.1
NBCI Gene record:
Fbxo3 (57443)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_149726.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092058 CGGATGATTATCGCTGTTCAT pLKO.1 480 3UTR 100% 4.950 6.930 N Fbxo3 n/a
2 TRCN0000327173 CGGATGATTATCGCTGTTCAT pLKO_005 480 3UTR 100% 4.950 6.930 N Fbxo3 n/a
3 TRCN0000092060 GCTATGTTAGTCGAAGACTTA pLKO.1 174 3UTR 100% 4.950 3.960 N Fbxo3 n/a
4 TRCN0000354249 GCTATGTTAGTCGAAGACTTA pLKO_005 174 3UTR 100% 4.950 3.960 N Fbxo3 n/a
5 TRCN0000092059 GCGGAATAAGAACGAAGTGTT pLKO.1 709 3UTR 100% 4.950 3.465 N Fbxo3 n/a
6 TRCN0000327100 GCGGAATAAGAACGAAGTGTT pLKO_005 709 3UTR 100% 4.950 3.465 N Fbxo3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_149726.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02948 pDONR223 100% 38.9% None (many diffs) n/a
2 ccsbBroad304_02948 pLX_304 0% 38.9% V5 (many diffs) n/a
3 TRCN0000466992 ACTAGTCCCATTTAAAGACCATTC pLX_317 26.9% 38.9% V5 (many diffs) n/a
Download CSV