Transcript: Human NR_158611.1

Homo sapiens L3MBTL histone methyl-lysine binding protein 4 (L3MBTL4), transcript variant 11, non-coding RNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
L3MBTL4 (91133)
Length:
5633
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_158611.1
NBCI Gene record:
L3MBTL4 (91133)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_158611.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419370 GTTCATGAATACATCGTTAAT pLKO_005 4500 3UTR 100% 13.200 18.480 N L3MBTL4 n/a
2 TRCN0000430371 TATCCGTGGTCCACGTTATTC pLKO_005 3512 3UTR 100% 13.200 18.480 N L3MBTL4 n/a
3 TRCN0000015982 CCTCTGTAGTTTGAACTTCAA pLKO.1 3665 3UTR 100% 4.950 6.930 N L3MBTL4 n/a
4 TRCN0000015981 GCGAACGAATGACCTGAAGAT pLKO.1 3440 3UTR 100% 4.950 6.930 N L3MBTL4 n/a
5 TRCN0000015978 CCAGGTTAATTCGTGTTGCTA pLKO.1 3274 3UTR 100% 3.000 4.200 N L3MBTL4 n/a
6 TRCN0000015979 CCATCGGTATTCTGTGTGCTT pLKO.1 2637 3UTR 100% 2.640 3.696 N L3MBTL4 n/a
7 TRCN0000425909 GCACATCCCTAAGGGTTATAG pLKO_005 2792 3UTR 100% 13.200 9.240 N L3MBTL4 n/a
8 TRCN0000015980 GCTACGATTGTAGATGTTGAT pLKO.1 3291 3UTR 100% 4.950 3.465 N L3MBTL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_158611.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14337 pDONR223 100% 25.2% None (many diffs) n/a
2 ccsbBroad304_14337 pLX_304 0% 25.2% V5 (many diffs) n/a
3 TRCN0000465457 ACTCAATCTGAGCTGACAATACGA pLX_317 16.7% 25.2% V5 (many diffs) n/a
Download CSV