Transcript: Human NR_158629.1

Homo sapiens inositol polyphosphate-5-phosphatase B (INPP5B), transcript variant 12, non-coding RNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
INPP5B (3633)
Length:
4729
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_158629.1
NBCI Gene record:
INPP5B (3633)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_158629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051674 GCGGGAACATACAATGTAAAT pLKO.1 1005 3UTR 100% 13.200 18.480 N INPP5B n/a
2 TRCN0000051677 GCTAGCATATTTGGCAGCTTA pLKO.1 2995 3UTR 100% 4.950 6.930 N INPP5B n/a
3 TRCN0000359852 TGTCGGACAAGGCTCATATTT pLKO_005 886 3UTR 100% 15.000 10.500 N INPP5B n/a
4 TRCN0000305895 ATATTCTAGCTAGCATATTTG pLKO_005 2987 3UTR 100% 13.200 9.240 N Inpp5b n/a
5 TRCN0000051673 GCCCAGATAATGGCTCAATAA pLKO.1 4220 3UTR 100% 13.200 9.240 N INPP5B n/a
6 TRCN0000051675 GCAGCCCACATTGAAGAGTAT pLKO.1 1404 3UTR 100% 4.950 3.465 N INPP5B n/a
7 TRCN0000051676 GCTCCCTGGATAAGATGGAAA pLKO.1 2099 3UTR 100% 4.950 3.465 N INPP5B n/a
8 TRCN0000359851 GGATACTGGAATGATTGATAA pLKO_005 2730 3UTR 100% 13.200 7.920 N INPP5B n/a
9 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3828 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 449 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 449 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_158629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11616 pDONR223 100% 3.6% None (many diffs) n/a
2 ccsbBroad304_11616 pLX_304 0% 3.6% V5 (many diffs) n/a
3 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 3.6% V5 (many diffs) n/a
Download CSV