Transcript: Human NR_159493.1

Homo sapiens glycosyltransferase 1 domain containing 1 (GLT1D1), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
GLT1D1 (144423)
Length:
2929
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_159493.1
NBCI Gene record:
GLT1D1 (144423)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_159493.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244006 GGATTTAGAAGTACCGGTATT pLKO_005 796 3UTR 100% 10.800 15.120 N GLT1D1 n/a
2 TRCN0000257200 TGGTTAGTGATCCTGCATTAG pLKO_005 915 3UTR 100% 10.800 15.120 N GLT1D1 n/a
3 TRCN0000244004 GTCGCTTTCACAGAGTCAATG pLKO_005 435 3UTR 100% 10.800 8.640 N GLT1D1 n/a
4 TRCN0000244005 GTGGACAATAGAGGCTTATTT pLKO_005 1372 3UTR 100% 15.000 10.500 N GLT1D1 n/a
5 TRCN0000146929 CCTCCACTGAATACTGAAATT pLKO.1 2032 3UTR 100% 13.200 9.240 N GLT1D1 n/a
6 TRCN0000244007 ATACGTGAGAATGTATCATTC pLKO_005 964 3UTR 100% 10.800 7.560 N GLT1D1 n/a
7 TRCN0000150003 CACAGAGTCAATGAAGGAAAT pLKO.1 443 3UTR 100% 10.800 7.560 N GLT1D1 n/a
8 TRCN0000148269 GCCTCCATCATGTAATAGAAT pLKO.1 2432 3UTR 100% 5.625 3.938 N GLT1D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_159493.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13224 pDONR223 100% 13.3% None (many diffs) n/a
2 ccsbBroad304_13224 pLX_304 0% 13.3% V5 (many diffs) n/a
3 TRCN0000468079 CTAACGTCTCAGGCCCGACTTGTC pLX_317 67% 13.3% V5 (many diffs) n/a
Download CSV