Transcript: Human NR_160427.1

Homo sapiens BMS1P4-AGAP5 readthough (BMS1P4-AGAP5), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-01-06
Taxon:
Homo sapiens (human)
Gene:
BMS1P4-AGAP5 (113939925)
Length:
3796
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160427.1
NBCI Gene record:
BMS1P4-AGAP5 (113939925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263045 ATGGCGTGCTCACCTATTATT pLKO_005 2340 3UTR 100% 15.000 7.500 Y AGAP4 n/a
2 TRCN0000048386 CCCTCTCCTCATGCCAATAAA pLKO.1 2588 3UTR 100% 15.000 7.500 Y BMS1P1 n/a
3 TRCN0000262358 CGGTGGATCCGTTCCAAATAT pLKO_005 3104 3UTR 100% 15.000 7.500 Y AGAP6 n/a
4 TRCN0000262356 TGCGCTGGTCCAACCTGTTTA pLKO_005 2154 3UTR 100% 13.200 6.600 Y AGAP6 n/a
5 TRCN0000263046 TTGGAGATACCTCATCATATC pLKO_005 1916 3UTR 100% 10.800 5.400 Y AGAP4 n/a
6 TRCN0000151705 CACAAAGAGATGCAGATAGAT pLKO.1 1938 3UTR 100% 5.625 2.813 Y AGAP4 n/a
7 TRCN0000152204 CAGGAAGGTTATGTCATCTAT pLKO.1 2995 3UTR 100% 5.625 2.813 Y AGAP4 n/a
8 TRCN0000048407 CCAGCCAGCATTATCTTACAA pLKO.1 1875 3UTR 100% 5.625 2.813 Y AGAP5 n/a
9 TRCN0000048384 CCTTGGAGATACCTCATCATA pLKO.1 1914 3UTR 100% 5.625 2.813 Y BMS1P1 n/a
10 TRCN0000153941 CCTTGGAGATACCTCATCATA pLKO.1 1914 3UTR 100% 5.625 2.813 Y AGAP4 n/a
11 TRCN0000048387 CCTTCGGACATCTACCATCAA pLKO.1 2407 3UTR 100% 4.950 2.475 Y BMS1P1 n/a
12 TRCN0000048406 GAACTCTCAAACAGATGCTTT pLKO.1 1687 3UTR 100% 4.950 2.475 Y AGAP5 n/a
13 TRCN0000156808 GAATCCTAAGTGGGCCAGTTT pLKO.1 2866 3UTR 100% 4.950 2.475 Y AGAP4 n/a
14 TRCN0000048401 GCACATTACGAAGAACAGAAA pLKO.1 2008 3UTR 100% 4.950 2.475 Y AGAP7P n/a
15 TRCN0000048405 GTGTATTGAATGCTCAGGAAT pLKO.1 2905 3UTR 100% 4.950 2.475 Y AGAP5 n/a
16 TRCN0000048404 CCATGTATCTACTGAGCGTTT pLKO.1 1804 3UTR 100% 4.050 2.025 Y AGAP5 n/a
17 TRCN0000048399 CCGTTCCAAATATGAGGAGAA pLKO.1 3112 3UTR 100% 4.050 2.025 Y AGAP7P n/a
18 TRCN0000154162 CCGTTCCAAATATGAGGAGAA pLKO.1 3112 3UTR 100% 4.050 2.025 Y AGAP4 n/a
19 TRCN0000048403 AGGAAATCACAAATTCAGCTA pLKO.1 3549 3UTR 100% 2.640 1.320 Y AGAP5 n/a
20 TRCN0000154067 CCAACCTGTTTACATCTGAGA pLKO.1 2163 3UTR 100% 2.640 1.320 Y AGAP4 n/a
21 TRCN0000152610 GCCTGAAGCTTTGGAGTTTAA pLKO.1 1627 3UTR 100% 13.200 6.600 Y AGAP4 n/a
22 TRCN0000263044 GAAATCACAAATTCAGCTAAT pLKO_005 3551 3UTR 100% 10.800 5.400 Y AGAP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160427.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10370 pDONR223 100% 7.2% None (many diffs) n/a
2 ccsbBroad304_10370 pLX_304 0% 7.2% V5 (many diffs) n/a
3 TRCN0000467881 ATCACAGGCGGCGTAGCCGACCCG pLX_317 71.9% 7.2% V5 (many diffs) n/a
Download CSV