Transcript: Human NR_160540.1

Homo sapiens zinc finger protein 286B (pseudogene) (ZNF286B), non-coding RNA.

Source:
NCBI, updated 2019-01-18
Taxon:
Homo sapiens (human)
Gene:
ZNF286B (729288)
Length:
5231
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_160540.1
NBCI Gene record:
ZNF286B (729288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_160540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235273 ACTGGAGAGAAACCTTATAAA pLKO_005 1286 3UTR 100% 15.000 7.500 Y Gm10771 n/a
2 TRCN0000337271 ACTGGAGAGAAACCTTATAAA pLKO_005 1286 3UTR 100% 15.000 7.500 Y ZNF286B n/a
3 TRCN0000350860 GGTTCTTTATGTCCGTTAATT pLKO_005 1879 3UTR 100% 15.000 7.500 Y ZNF286B n/a
4 TRCN0000337317 ACGTTGGAGAGAGACCTTATG pLKO_005 1116 3UTR 100% 10.800 5.400 Y ZNF286B n/a
5 TRCN0000015155 GCCACAGAGCTAATTTAACTA pLKO.1 999 3UTR 100% 5.625 2.813 Y ZNF286A n/a
6 TRCN0000015153 GCAGAGAACTTATAAAGAGAA pLKO.1 856 3UTR 100% 4.950 2.475 Y ZNF286A n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2625 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 953 3UTR 100% 15.000 7.500 Y ZNF443 n/a
9 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 953 3UTR 100% 15.000 7.500 Y Zfp97 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2625 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_160540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12340 pDONR223 100% 23.2% None (many diffs) n/a
2 ccsbBroad304_12340 pLX_304 0% 23.2% V5 (many diffs) n/a
3 TRCN0000480946 CGGGCTCAATCCGAGCGGCAACGA pLX_317 30% 23.2% V5 (many diffs) n/a
Download CSV