Transcript: Human NR_161443.2

Homo sapiens small nuclear RNA activating complex polypeptide 3 (SNAPC3), transcript variant 17, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SNAPC3 (6619)
Length:
6559
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_161443.2
NBCI Gene record:
SNAPC3 (6619)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_161443.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019089 GCGGCCTTGATAAACTGAAAT pLKO.1 315 3UTR 100% 13.200 18.480 N SNAPC3 n/a
2 TRCN0000019090 GCAGACAAGAAACATTCGTTT pLKO.1 453 3UTR 100% 4.950 3.960 N SNAPC3 n/a
3 TRCN0000280836 GCAGACAAGAAACATTCGTTT pLKO_005 453 3UTR 100% 4.950 3.960 N SNAPC3 n/a
4 TRCN0000019092 GCATTGGCTATGGACCAGAAA pLKO.1 809 3UTR 100% 4.950 3.465 N SNAPC3 n/a
5 TRCN0000280765 GCATTGGCTATGGACCAGAAA pLKO_005 809 3UTR 100% 4.950 3.465 N SNAPC3 n/a
6 TRCN0000019093 CTTGTGTATTAAACTGGGTTT pLKO.1 671 3UTR 100% 4.050 2.835 N SNAPC3 n/a
7 TRCN0000280764 CTTGTGTATTAAACTGGGTTT pLKO_005 671 3UTR 100% 4.050 2.835 N SNAPC3 n/a
8 TRCN0000019091 CCCATGATAGAGGCTATGGAA pLKO.1 610 3UTR 100% 3.000 2.100 N SNAPC3 n/a
9 TRCN0000280763 CCCATGATAGAGGCTATGGAA pLKO_005 610 3UTR 100% 3.000 2.100 N SNAPC3 n/a
10 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 6012 3UTR 100% 4.050 2.025 Y TLCD4 n/a
11 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 6107 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_161443.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01562 pDONR223 100% 14.7% None 1_4delGAAC;584_585ins233;1005_6559del n/a
2 ccsbBroad304_01562 pLX_304 0% 14.7% V5 1_4delGAAC;584_585ins233;1005_6559del n/a
3 TRCN0000470156 CTATCGTCGTGCAATTATATCCCT pLX_317 39% 14.7% V5 1_4delGAAC;584_585ins233;1005_6559del n/a
4 ccsbBroadEn_11147 pDONR223 100% 10.6% None (many diffs) n/a
5 ccsbBroad304_11147 pLX_304 0% 10.6% V5 (many diffs) n/a
6 TRCN0000471476 TCACTGGTGAATTAAAAGGGCCCC pLX_317 68.8% 10.6% V5 (many diffs) n/a
Download CSV