Transcript: Human NR_164350.1

Homo sapiens RAB5 interacting factor (RAB5IF), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
RAB5IF (55969)
Length:
1050
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_164350.1
NBCI Gene record:
RAB5IF (55969)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_164350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155433 CAAAGTCTCCGTCTGGAGTAA pLKO.1 233 3UTR 100% 4.950 6.930 N RAB5IF n/a
2 TRCN0000285287 CAAAGTCTCCGTCTGGAGTAA pLKO_005 233 3UTR 100% 4.950 6.930 N RAB5IF n/a
3 TRCN0000183748 CCATCAAGTAACAGCTATTAT pLKO.1 791 3UTR 100% 15.000 7.500 Y RAB5IF n/a
4 TRCN0000275129 TTTACACTGCCATCCATTATG pLKO_005 519 3UTR 100% 13.200 6.600 Y RAB5IF n/a
5 TRCN0000155232 GCACCTCTGGATTCAGATGAA pLKO.1 842 3UTR 100% 4.950 2.475 Y RAB5IF n/a
6 TRCN0000275128 GCACCTCTGGATTCAGATGAA pLKO_005 842 3UTR 100% 4.950 2.475 Y RAB5IF n/a
7 TRCN0000151946 CCATTTCTTCTTGGATACCAT pLKO.1 774 3UTR 100% 3.000 1.500 Y RAB5IF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_164350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03688 pDONR223 100% 28.2% None (many diffs) n/a
2 ccsbBroad304_03688 pLX_304 0% 28.2% V5 (many diffs) n/a
3 TRCN0000466507 TTTCTGGTAGCCAAGGGACACTAG pLX_317 90.4% 28.1% V5 (many diffs) n/a
4 ccsbBroadEn_15919 pDONR223 0% 24.8% None 1_173del;435_1050del n/a
5 ccsbBroad304_15919 pLX_304 0% 24.8% V5 1_173del;435_1050del n/a
Download CSV