Transcript: Human NR_164641.1

Homo sapiens NIMA related kinase 3 (NEK3), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
NEK3 (4752)
Length:
2078
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_164641.1
NBCI Gene record:
NEK3 (4752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_164641.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194949 CTAATATTGTTGCCTTCAAAG pLKO.1 291 3UTR 100% 10.800 15.120 N NEK3 n/a
2 TRCN0000001473 CGAAGCATAACACACCAAGAA pLKO.1 963 3UTR 100% 4.950 6.930 N NEK3 n/a
3 TRCN0000001471 GCAGTCCCATAGAACAGAAAT pLKO.1 1823 3UTR 100% 13.200 10.560 N NEK3 n/a
4 TRCN0000194828 CCCAATTTCCTCAACCATAAA pLKO.1 1906 3UTR 100% 13.200 9.240 N NEK3 n/a
5 TRCN0000001474 CCAGTTCACCAAATCTTCATA pLKO.1 1120 3UTR 100% 5.625 3.938 N NEK3 n/a
6 TRCN0000197186 GCCGTCTCATTACTCCTATGA pLKO.1 778 3UTR 100% 4.950 3.465 N NEK3 n/a
7 TRCN0000001472 CCTTATTATGTGCCTCCAGAA pLKO.1 608 3UTR 100% 4.050 2.835 N NEK3 n/a
8 TRCN0000197182 GTACCCTTAAGCATCCATTTC pLKO.1 699 3UTR 100% 0.000 0.000 N NEK3 n/a
9 TRCN0000001475 CCTAGTCAAGCAGATGTTTAA pLKO.1 808 3UTR 100% 13.200 7.920 N NEK3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_164641.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14711 pDONR223 0% 68.9% None 1_112del;989_990ins50;1581_2078del n/a
2 ccsbBroad304_14711 pLX_304 0% 68.9% V5 1_112del;989_990ins50;1581_2078del n/a
3 TRCN0000465913 ACTGATCCGGAGACCTCTTGCGGG pLX_317 16.8% 68.9% V5 1_112del;989_990ins50;1581_2078del n/a
4 TRCN0000489322 TTTTATGGAACCTATCATTCAATT pLX_317 24.9% 68.9% V5 (not translated due to prior stop codon) 1_112del;989_990ins50;1581_2078del n/a
Download CSV