Transcript: Mouse NM_027949.1

Mus musculus PHD finger protein 7 (Phf7), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Phf7 (71838)
Length:
1984
CDS:
584..1507

Additional Resources:

NCBI RefSeq record:
NM_027949.1
NBCI Gene record:
Phf7 (71838)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082219 CGCAAGTGTATCCAGAAATAT pLKO.1 1142 CDS 100% 15.000 21.000 N Phf7 n/a
2 TRCN0000301954 CGCAAGTGTATCCAGAAATAT pLKO_005 1142 CDS 100% 15.000 21.000 N Phf7 n/a
3 TRCN0000082221 CCGAACAAGTGTTGAGAACAT pLKO.1 1087 CDS 100% 4.950 6.930 N Phf7 n/a
4 TRCN0000301890 CCGAACAAGTGTTGAGAACAT pLKO_005 1087 CDS 100% 4.950 6.930 N Phf7 n/a
5 TRCN0000082222 AGACAATCTTTGTGTCCATTA pLKO.1 739 CDS 100% 10.800 7.560 N Phf7 n/a
6 TRCN0000301957 AGACAATCTTTGTGTCCATTA pLKO_005 739 CDS 100% 10.800 7.560 N Phf7 n/a
7 TRCN0000082220 CAGCAAGAAATGGGAATGTAA pLKO.1 1456 CDS 100% 5.625 3.938 N Phf7 n/a
8 TRCN0000301888 CAGCAAGAAATGGGAATGTAA pLKO_005 1456 CDS 100% 5.625 3.938 N Phf7 n/a
9 TRCN0000082218 CCCAGGACAGTGAGATACAAA pLKO.1 1760 3UTR 100% 5.625 3.938 N Phf7 n/a
10 TRCN0000301889 CCCAGGACAGTGAGATACAAA pLKO_005 1760 3UTR 100% 5.625 3.938 N Phf7 n/a
11 TRCN0000016793 CCCACACATCAGCAAAGCATT pLKO.1 1164 CDS 100% 4.950 2.970 N PHF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08309 pDONR223 100% 70.2% 67.9% None (many diffs) n/a
2 ccsbBroad304_08309 pLX_304 0% 70.2% 67.9% V5 (many diffs) n/a
3 TRCN0000466092 GTCCATGTACCTGACATATATCTT pLX_317 31.7% 70.2% 67.9% V5 (many diffs) n/a
Download CSV