Transcript: Mouse NM_008938.1

Mus musculus peripherin 2 (Prph2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Prph2 (19133)
Length:
2632
CDS:
213..1253

Additional Resources:

NCBI RefSeq record:
NM_008938.1
NBCI Gene record:
Prph2 (19133)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034434 CGGACTCAAGAATGGGATGAA pLKO.1 608 CDS 100% 4.950 6.930 N Prph2 n/a
2 TRCN0000380206 GGCCTTTCTGGAGAGCTTTAA pLKO_005 1163 CDS 100% 13.200 9.240 N Prph2 n/a
3 TRCN0000381314 GTCCAGCTGAAAGTCCAAATT pLKO_005 1318 3UTR 100% 13.200 9.240 N Prph2 n/a
4 TRCN0000380977 TCCTTAGGGCAGGTTACAAAC pLKO_005 1396 3UTR 100% 10.800 7.560 N Prph2 n/a
5 TRCN0000381728 TCTCCTCCAAGGAGGTCAAAG pLKO_005 772 CDS 100% 10.800 7.560 N Prph2 n/a
6 TRCN0000034435 CTGTTCTTGAAGATTGAACTT pLKO.1 327 CDS 100% 4.950 3.465 N Prph2 n/a
7 TRCN0000034437 GAATTACTACAGCAGCCTCAT pLKO.1 977 CDS 100% 4.050 2.835 N Prph2 n/a
8 TRCN0000034436 TCAGTGGATCAGCAATCGCTA pLKO.1 743 CDS 100% 2.640 1.848 N Prph2 n/a
9 TRCN0000034438 CGTCCCTTTCAGCTGCTGCAA pLKO.1 836 CDS 100% 0.880 0.616 N Prph2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06854 pDONR223 100% 87.4% 91% None (many diffs) n/a
2 ccsbBroad304_06854 pLX_304 0% 87.4% 91% V5 (many diffs) n/a
3 TRCN0000476716 AAACCAGCATGCCCAAGATACGTA pLX_317 34.8% 87.4% 91% V5 (many diffs) n/a
Download CSV