Transcript: Human NM_001004052.1

Homo sapiens olfactory receptor family 52 subfamily B member 2 (OR52B2), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
OR52B2 (255725)
Length:
972
CDS:
1..972

Additional Resources:

NCBI RefSeq record:
NM_001004052.1
NBCI Gene record:
OR52B2 (255725)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063275 CCACCTCTGTGTCATCCTTAT pLKO.1 735 CDS 100% 10.800 7.560 N OR52B2 n/a
2 TRCN0000063276 CTTATCACATTTGGCTGTCAA pLKO.1 71 CDS 100% 4.950 3.465 N OR52B2 n/a
3 TRCN0000063277 GTCATGGTCATCTTGGATGTT pLKO.1 619 CDS 100% 4.950 3.465 N OR52B2 n/a
4 TRCN0000063273 CCCAGTCATATTCTTGCTGAA pLKO.1 477 CDS 100% 4.050 2.835 N OR52B2 n/a
5 TRCN0000063274 CCCAAGGCTTCTTTGTCCATA pLKO.1 302 CDS 100% 4.950 2.970 N OR52B2 n/a
6 TRCN0000203340 CCCATGTATTTCTTCCTCTGT pLKO.1 178 CDS 100% 2.640 1.320 Y Olfr457 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05309 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05309 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477834 GTTTACCTGATGACCTTCCGGGGA pLX_317 31.2% 100% 100% V5 n/a
4 TRCN0000488277 CCGAGTTCGCCTCCTATACGTGTT pLX_317 31.3% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000491509 GCGTTGAAGCTGGTTCCTGGGATT pLX_317 28.7% 99.8% 99.6% V5 969_970insG n/a
Download CSV