Transcript: Mouse NM_021439.2

Mus musculus carbohydrate sulfotransferase 11 (Chst11), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Chst11 (58250)
Length:
5532
CDS:
369..1427

Additional Resources:

NCBI RefSeq record:
NM_021439.2
NBCI Gene record:
Chst11 (58250)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021439.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103334 CCACGAACTCATCTACTGCTA pLKO.1 713 CDS 100% 2.640 3.696 N Chst11 n/a
2 TRCN0000103330 CGGCATGGTTAAGAATTATTT pLKO.1 1573 3UTR 100% 15.000 12.000 N Chst11 n/a
3 TRCN0000103331 CGATGTCAAGTTCGAGGAGTT pLKO.1 1067 CDS 100% 4.050 3.240 N Chst11 n/a
4 TRCN0000103333 CGGATCCTTTATCTTGGTCAT pLKO.1 437 CDS 100% 4.050 3.240 N Chst11 n/a
5 TRCN0000103332 CGAAGTCTACAAACTGGACTT pLKO.1 1361 CDS 100% 0.405 0.324 N Chst11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021439.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000470969 AGCATCCGTTTTTAGTTGCCCGCT pLX_317 34.5% 91% 96.8% V5 (many diffs) n/a
2 ccsbBroadEn_08177 pDONR223 100% 90.9% 96.3% None (many diffs) n/a
3 ccsbBroad304_08177 pLX_304 0% 90.9% 96.3% V5 (many diffs) n/a
Download CSV