Transcript: Human NM_033013.2

Homo sapiens nuclear receptor subfamily 1 group I member 2 (NR1I2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NR1I2 (8856)
Length:
4335
CDS:
1840..3033

Additional Resources:

NCBI RefSeq record:
NM_033013.2
NBCI Gene record:
NR1I2 (8856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021620 CGAGCTGTGTCAACTGAGATT pLKO.1 2571 CDS 100% 4.950 3.960 N NR1I2 n/a
2 TRCN0000021623 CACTACCTTCTCCCATTTCAA pLKO.1 2328 CDS 100% 5.625 3.938 N NR1I2 n/a
3 TRCN0000021619 GCCTTGATCAAGCGGAAGAAA pLKO.1 2206 CDS 100% 5.625 3.938 N NR1I2 n/a
4 TRCN0000021622 CATGCTGAAATTCCACTACAT pLKO.1 2694 CDS 100% 4.950 3.465 N NR1I2 n/a
5 TRCN0000021621 CGGCATGAAGAAGGAGATGAT pLKO.1 2154 CDS 100% 4.950 3.465 N NR1I2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11312 pDONR223 100% 78.9% 78.9% None 1_165del;518_519ins108 n/a
2 ccsbBroad304_11312 pLX_304 0% 78.9% 78.9% V5 1_165del;518_519ins108 n/a
3 TRCN0000466920 CTTACGAAGTAAATTCTCACCAAT pLX_317 36% 78.9% 78.9% V5 1_165del;518_519ins108 n/a
4 TRCN0000488621 GTTCGACACCAGCTCGGATCGACC pLX_317 23.3% 78.9% 78.8% V5 1_165del;518_519ins108;1191_1192insG n/a
Download CSV