Transcript: Mouse NM_026443.4

Mus musculus mitochondrial fission process 1 (Mtfp1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mtfp1 (67900)
Length:
1396
CDS:
150..650

Additional Resources:

NCBI RefSeq record:
NM_026443.4
NBCI Gene record:
Mtfp1 (67900)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026443.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114565 CATCGACAGGTCAGTGGACTT pLKO.1 569 CDS 100% 4.050 5.670 N Mtfp1 n/a
2 TRCN0000337874 CTCTATGTCTTGGGTACTATG pLKO_005 471 CDS 100% 10.800 8.640 N Mtfp1 n/a
3 TRCN0000337873 GCAGAACCCTTAGAGGTTAAA pLKO_005 948 3UTR 100% 13.200 9.240 N Mtfp1 n/a
4 TRCN0000337798 TGGCCGATGCCATAGACAAAG pLKO_005 307 CDS 100% 10.800 7.560 N Mtfp1 n/a
5 TRCN0000350882 CTGTGGTGTGGTTGAGCTATG pLKO_005 265 CDS 100% 6.000 4.200 N Mtfp1 n/a
6 TRCN0000114562 CTCTCTATGTCTTGGGTACTA pLKO.1 469 CDS 100% 4.950 3.465 N Mtfp1 n/a
7 TRCN0000337872 CTTCACCATCAACCGTCTGTG pLKO_005 440 CDS 100% 4.050 2.835 N Mtfp1 n/a
8 TRCN0000114564 CCTGGCCGATGCCATAGACAA pLKO.1 305 CDS 100% 1.650 1.155 N Mtfp1 n/a
9 TRCN0000114561 GCCAGTCTTCTGGCTATTCTA pLKO.1 1199 3UTR 100% 0.563 0.394 N Mtfp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026443.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08311 pDONR223 100% 86.9% 86.7% None (many diffs) n/a
2 ccsbBroad304_08311 pLX_304 0% 86.9% 86.7% V5 (many diffs) n/a
3 TRCN0000466515 TTAGCCGATTTTAAACGTCAGTGT pLX_317 78.7% 86.9% 86.7% V5 (many diffs) n/a
4 ccsbBroadEn_03329 pDONR223 100% 86.7% 86.7% None (many diffs) n/a
5 ccsbBroad304_03329 pLX_304 0% 86.7% 86.7% V5 (many diffs) n/a
6 TRCN0000472384 TTCCGCCGGAATGGTGCTAATATG pLX_317 96.3% 86.7% 86.7% V5 (many diffs) n/a
Download CSV