Transcript: Mouse NM_133237.3

Mus musculus adenomatosis polyposis coli down-regulated 1 (Apcdd1), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Apcdd1 (494504)
Length:
2799
CDS:
338..1882

Additional Resources:

NCBI RefSeq record:
NM_133237.3
NBCI Gene record:
Apcdd1 (494504)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267563 GCATAGCCTGCCGCATCATTT pLKO_005 1128 CDS 100% 13.200 18.480 N Apcdd1 n/a
2 TRCN0000255138 CAACACCTGGGAAGGGCATTA pLKO_005 1294 CDS 100% 10.800 7.560 N Apcdd1 n/a
3 TRCN0000255141 CAAGACTCTTTACCGTGTATG pLKO_005 1899 3UTR 100% 10.800 7.560 N Apcdd1 n/a
4 TRCN0000255140 CCAACAGGATGTGACACATAC pLKO_005 1537 CDS 100% 10.800 7.560 N Apcdd1 n/a
5 TRCN0000255139 TACAGGTTCTACAACAATAAT pLKO_005 620 CDS 100% 15.000 9.000 N Apcdd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133237.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04996 pDONR223 100% 85.5% 91.8% None (many diffs) n/a
2 ccsbBroad304_04996 pLX_304 0% 85.5% 91.8% V5 (many diffs) n/a
3 TRCN0000466919 CTCCATATCTTCTCTAGTATATTA pLX_317 25% 85.5% 91.8% V5 (many diffs) n/a
Download CSV