Transcript: Mouse NM_001109685.1

Mus musculus kazrin, periplakin interacting protein (Kazn), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Kazn (71529)
Length:
3859
CDS:
210..1454

Additional Resources:

NCBI RefSeq record:
NM_001109685.1
NBCI Gene record:
Kazn (71529)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001109685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163756 GTACAGTCACTAGAGGATCTT pLKO.1 1281 CDS 100% 4.950 3.960 N KAZN n/a
2 TRCN0000164495 CAACCCTATTGTACAGTCACT pLKO.1 1271 CDS 100% 2.640 2.112 N KAZN n/a
3 TRCN0000164683 CGAGACTTCATCCGCAACTAT pLKO.1 711 CDS 100% 5.625 3.938 N KAZN n/a
4 TRCN0000164593 CCCTATTGTACAGTCACTAGA pLKO.1 1274 CDS 100% 4.950 3.465 N KAZN n/a
5 TRCN0000182832 CCCAGTTCAGAAGAGCCTATA pLKO.1 1250 CDS 100% 10.800 7.560 N Kazn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001109685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02742 pDONR223 100% 72.3% 77.5% None (many diffs) n/a
2 ccsbBroad304_02742 pLX_304 0% 72.3% 77.5% V5 (many diffs) n/a
3 TRCN0000465891 AAGTTGCACTGGAGATTTACGACA pLX_317 31.3% 72.3% 77.5% V5 (many diffs) n/a
Download CSV