Transcript: Mouse NM_173732.3

Mus musculus nuclear envelope integral membrane protein 1 (Nemp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Nemp1 (210035)
Length:
1521
CDS:
34..1011

Additional Resources:

NCBI RefSeq record:
NM_173732.3
NBCI Gene record:
Nemp1 (210035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173732.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194186 GCAGTTTAGTATCTGGAACTT pLKO.1 351 CDS 100% 4.950 3.960 N Nemp1 n/a
2 TRCN0000174998 GCATTATCTTCTAAGCTACAT pLKO.1 768 CDS 100% 4.950 3.960 N Nemp1 n/a
3 TRCN0000444547 TTCCTTTCTCTGTTGAGATAA pLKO_005 1127 3UTR 100% 13.200 9.240 N Nemp1 n/a
4 TRCN0000443028 TGCACTAAGAACCTGGAATAC pLKO_005 958 CDS 100% 10.800 7.560 N Nemp1 n/a
5 TRCN0000174819 GAATCCCAAGTTGATATGAAT pLKO.1 190 CDS 100% 5.625 3.938 N Nemp1 n/a
6 TRCN0000194647 GCAGCGAAAGGATGCTTAGTT pLKO.1 1058 3UTR 100% 5.625 3.938 N Nemp1 n/a
7 TRCN0000173222 CCTCAAGTTCAGGTTTCAGAT pLKO.1 1251 3UTR 100% 4.950 3.465 N Nemp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173732.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02749 pDONR223 100% 48.5% 46.4% None (many diffs) n/a
2 ccsbBroad304_02749 pLX_304 0% 48.5% 46.4% V5 (many diffs) n/a
3 TRCN0000478671 CACAGTCCCGAGGGACATCACTGG pLX_317 42% 48.5% 46.4% V5 (many diffs) n/a
Download CSV