Transcript: Mouse NM_001033275.4

Mus musculus glucoside xylosyltransferase 1 (Gxylt1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gxylt1 (223827)
Length:
6534
CDS:
4..1122

Additional Resources:

NCBI RefSeq record:
NM_001033275.4
NBCI Gene record:
Gxylt1 (223827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033275.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253044 ATCCGTTGGCTGACGTGATAT pLKO_005 2929 3UTR 100% 13.200 10.560 N Gxylt1 n/a
2 TRCN0000253043 TGGTCCTTCCTGCGGAGATTT pLKO_005 391 CDS 100% 13.200 7.920 N Gxylt1 n/a
3 TRCN0000253045 CCCAGAATTGGATGGTATAAT pLKO_005 646 CDS 100% 15.000 7.500 Y Gxylt1 n/a
4 TRCN0000253042 CCGACCAGATCACTGTATATA pLKO_005 918 CDS 100% 15.000 7.500 Y Gxylt1 n/a
5 TRCN0000253046 TACGACCTGTTGATGATATTT pLKO_005 563 CDS 100% 15.000 7.500 Y Gxylt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033275.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09944 pDONR223 100% 70.2% 68.2% None (many diffs) n/a
2 ccsbBroad304_09944 pLX_304 0% 70.2% 68.2% V5 (many diffs) n/a
3 TRCN0000475752 ACCTACACTGGTCACGGAGATTGT pLX_317 21.9% 70.2% 68.2% V5 (many diffs) n/a
Download CSV