Transcript: Mouse NM_001113384.1

Mus musculus guanine nucleotide binding protein, alpha O (Gnao1), transcript variant B, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Gnao1 (14681)
Length:
6022
CDS:
499..1563

Additional Resources:

NCBI RefSeq record:
NM_001113384.1
NBCI Gene record:
Gnao1 (14681)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113384.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097759 TCTCGGGAGTATCAGCTCAAT pLKO.1 928 CDS 100% 4.950 6.930 N Gnao1 n/a
2 TRCN0000036484 GCCGCCAAAGACGTGAAATTA pLKO.1 586 CDS 100% 15.000 10.500 N GNAO1 n/a
3 TRCN0000328024 GCCGCCAAAGACGTGAAATTA pLKO_005 586 CDS 100% 15.000 10.500 N Gnao1 n/a
4 TRCN0000328026 TCAACCGATCTCGGGAGTATC pLKO_005 920 CDS 100% 10.800 7.560 N Gnao1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113384.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10852 pDONR223 100% 73% 77.6% None (many diffs) n/a
2 ccsbBroad304_10852 pLX_304 0% 73% 77.6% V5 (many diffs) n/a
3 TRCN0000470559 CGCAGTCCCGCCTCCTCAACACCG pLX_317 39.9% 73% 77.6% V5 (many diffs) n/a
Download CSV