Transcript: Human NM_152523.2

Homo sapiens cyclin Y like 1 (CCNYL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
CCNYL1 (151195)
Length:
3674
CDS:
316..1185

Additional Resources:

NCBI RefSeq record:
NM_152523.2
NBCI Gene record:
CCNYL1 (151195)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420941 ATCAATGCAGTATTACCATTA pLKO_005 1607 3UTR 100% 10.800 7.560 N CCNYL1 n/a
2 TRCN0000428635 TGAGAGATCACATCCACTTAC pLKO_005 603 CDS 100% 10.800 7.560 N CCNYL1 n/a
3 TRCN0000150218 GCAACCATTTGAACCATGTAT pLKO.1 419 CDS 100% 5.625 3.938 N CCNYL1 n/a
4 TRCN0000432102 TCCTTAGCAGATGACAACAAC pLKO_005 1003 CDS 100% 4.950 3.465 N CCNYL1 n/a
5 TRCN0000147859 GCCAAATACTACTTTGACCTT pLKO.1 979 CDS 100% 2.640 1.848 N CCNYL1 n/a
6 TRCN0000148207 GCAAATAGATCCCTGGATATT pLKO.1 577 CDS 100% 13.200 7.920 N CCNYL1 n/a
7 TRCN0000421205 CTGATAACTTCATTGGTATTC pLKO_005 1139 CDS 100% 10.800 6.480 N CCNYL1 n/a
8 TRCN0000148097 GCTGTGAACTATGTAAGGTTT pLKO.1 1477 3UTR 100% 4.950 2.970 N CCNYL1 n/a
9 TRCN0000147650 GAGGACATGAATGAAATGGAA pLKO.1 904 CDS 100% 3.000 1.500 Y CCNYL1 n/a
10 TRCN0000252443 ATTGGTATTCAGCGCTCTAAT pLKO_005 1150 CDS 100% 13.200 7.920 N Ccnyl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152523.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13274 pDONR223 100% 82.3% 79.2% None 121_221del;258_309del n/a
2 ccsbBroad304_13274 pLX_304 0% 82.3% 79.2% V5 121_221del;258_309del n/a
3 TRCN0000477857 TCCGGTGGTTTGAGCGACAGGCCA pLX_317 58.2% 82.3% 79.2% V5 121_221del;258_309del n/a
Download CSV