Transcript: Mouse NM_133923.6

Mus musculus tubulin tyrosine ligase-like family, member 3 (Ttll3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ttll3 (101100)
Length:
3125
CDS:
1..2784

Additional Resources:

NCBI RefSeq record:
NM_133923.6
NBCI Gene record:
Ttll3 (101100)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133923.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248588 CCTTCAGCGCTACTACCAAAT pLKO_005 1278 CDS 100% 10.800 15.120 N Ttll3 n/a
2 TRCN0000248590 TTTACGCCGAGGCTGCTATTC pLKO_005 2808 3UTR 100% 10.800 15.120 N Ttll3 n/a
3 TRCN0000248589 ATCCGAGCTCCGCACCAATTT pLKO_005 114 CDS 100% 13.200 10.560 N Ttll3 n/a
4 TRCN0000048531 GAGCCTTTGAGCTCATCTATA pLKO.1 2108 CDS 100% 13.200 9.240 N TTLL3 n/a
5 TRCN0000248587 TCAAGCAGAAGAAGATCTTTA pLKO_005 488 CDS 100% 13.200 9.240 N Ttll3 n/a
6 TRCN0000248591 ATGTCCCGCATGGTTCGAAAT pLKO_005 757 CDS 100% 10.800 7.560 N Ttll3 n/a
7 TRCN0000200873 GATGACAAGAAAGCCTTCATA pLKO.1 982 CDS 100% 5.625 3.938 N Ttll3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133923.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11816 pDONR223 100% 40% 39.4% None (many diffs) n/a
2 ccsbBroad304_11816 pLX_304 0% 40% 39.4% V5 (many diffs) n/a
3 TRCN0000468424 CTGGGGCCATCTACCTTAAAATCA pLX_317 20.2% 40% 39.4% V5 (many diffs) n/a
4 ccsbBroadEn_11815 pDONR223 100% 9.7% 9.9% None (many diffs) n/a
5 ccsbBroad304_11815 pLX_304 0% 9.7% 9.9% V5 (many diffs) n/a
6 TRCN0000472522 TCCTGTGGTGATCTGAGCGCGTCT pLX_317 90.7% 9.7% 9.9% V5 (many diffs) n/a
Download CSV