Transcript: Mouse NM_175406.3

Mus musculus ATPase, H+ transporting, lysosomal V0 subunit D2 (Atp6v0d2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Atp6v0d2 (242341)
Length:
2518
CDS:
70..1122

Additional Resources:

NCBI RefSeq record:
NM_175406.3
NBCI Gene record:
Atp6v0d2 (242341)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101391 GCAGACGTTATGTGTCCCATT pLKO.1 682 CDS 100% 4.050 5.670 N Atp6v0d2 n/a
2 TRCN0000101390 GCCATGAAGTTATTGAGGAAA pLKO.1 1150 3UTR 100% 4.950 3.960 N Atp6v0d2 n/a
3 TRCN0000101394 TGGCAGATAATTATGGAGTTT pLKO.1 869 CDS 100% 4.950 3.960 N Atp6v0d2 n/a
4 TRCN0000101392 GCAGCTATATGATAGACAATA pLKO.1 374 CDS 100% 13.200 7.920 N Atp6v0d2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05281 pDONR223 100% 87.7% 93.1% None (many diffs) n/a
2 ccsbBroad304_05281 pLX_304 0% 87.7% 93.1% V5 (many diffs) n/a
3 TRCN0000475639 TTAGACGCAAGAACTCCGTTCGCC pLX_317 29.3% 87.7% 93.1% V5 (many diffs) n/a
Download CSV