Transcript: Mouse NM_001163170.1

Mus musculus Lix1-like (Lix1l), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lix1l (280411)
Length:
2509
CDS:
50..1063

Additional Resources:

NCBI RefSeq record:
NM_001163170.1
NBCI Gene record:
Lix1l (280411)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133925 CCACAAGGAGAAGAAAGATAT pLKO.1 991 CDS 100% 13.200 9.240 N LIX1L n/a
2 TRCN0000135165 CCTATTTGCTAAGAGATCCCT pLKO.1 1210 3UTR 100% 0.750 0.525 N LIX1L n/a
3 TRCN0000297578 CCTATTTGCTAAGAGATCCCT pLKO_005 1210 3UTR 100% 0.750 0.525 N LIX1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163170.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04834 pDONR223 100% 90.4% 97% None (many diffs) n/a
2 ccsbBroad304_04834 pLX_304 0% 90.4% 97% V5 (many diffs) n/a
3 TRCN0000477728 ATGCCCTGAATGTTCTGGGTGTGC pLX_317 42.2% 90.4% 97% V5 (many diffs) n/a
Download CSV