Transcript: Mouse NM_001163419.1

Mus musculus family with sequence similarity 172, member A (Fam172a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fam172a (68675)
Length:
3912
CDS:
197..1312

Additional Resources:

NCBI RefSeq record:
NM_001163419.1
NBCI Gene record:
Fam172a (68675)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346939 GTGGGCTAGAAGGCTTATTAT pLKO_005 550 CDS 100% 15.000 21.000 N Fam172a n/a
2 TRCN0000347009 GTCGTGATGTGTCCGTCTAAA pLKO_005 1384 3UTR 100% 13.200 18.480 N Fam172a n/a
3 TRCN0000346936 ACAAAGAAGCGTCGTGATTTC pLKO_005 770 CDS 100% 10.800 8.640 N Fam172a n/a
4 TRCN0000346938 TTTGCTGTCTAGGATCGATTT pLKO_005 166 5UTR 100% 10.800 8.640 N Fam172a n/a
5 TRCN0000347007 GGCGAGATCATCACAAGATAT pLKO_005 362 CDS 100% 13.200 9.240 N Fam172a n/a
6 TRCN0000147818 GCTTTGACAAATCCACAGAAA pLKO.1 485 CDS 100% 4.950 2.970 N FAM172A n/a
7 TRCN0000352960 GCTTTGACAAATCCACAGAAA pLKO_005 485 CDS 100% 4.950 2.970 N FAM172A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04314 pDONR223 100% 79.8% 83.6% None (many diffs) n/a
2 ccsbBroad304_04314 pLX_304 0% 79.8% 83.6% V5 (many diffs) n/a
3 TRCN0000479117 CGCCGGTCCCAGCCCATAGAACCT pLX_317 34.4% 79.8% 83.6% V5 (many diffs) n/a
Download CSV