Transcript: Human NR_028394.1

Homo sapiens TSNAX-DISC1 readthrough (NMD candidate) (TSNAX-DISC1), transcript variant 2, long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
TSNAX-DISC1 (100303453)
Length:
3557
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028394.1
NBCI Gene record:
TSNAX-DISC1 (100303453)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118997 CCGAGGAGATTAGATCATTAA pLKO.1 2672 3UTR 100% 13.200 6.600 Y DISC1 n/a
2 TRCN0000118998 GAGACGTTACAACAAAGATTA pLKO.1 1969 3UTR 100% 13.200 6.600 Y DISC1 n/a
3 TRCN0000119000 GCAGTTGAGAATGATGATTAT pLKO.1 1939 3UTR 100% 13.200 6.600 Y DISC1 n/a
4 TRCN0000160261 CATGACAAATATGAGAGACTT pLKO.1 306 3UTR 100% 4.950 2.475 Y TSNAX n/a
5 TRCN0000160011 CGGGATATAACTGTTGAAAGT pLKO.1 339 3UTR 100% 4.950 2.475 Y TSNAX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08070 pDONR223 100% 61.5% None (many diffs) n/a
2 ccsbBroad304_08070 pLX_304 0% 61.5% V5 (many diffs) n/a
3 TRCN0000477691 ATACGATCGAGTTAACGTCAACCC pLX_317 15.6% 61.5% V5 (many diffs) n/a
4 ccsbBroadEn_01718 pDONR223 100% 21.1% None (many diffs) n/a
5 ccsbBroad304_01718 pLX_304 0% 21.1% V5 (many diffs) n/a
6 TRCN0000472121 CGTGGCCTAATTTCCCAGTTTGCC pLX_317 42.4% 21.1% V5 (many diffs) n/a
Download CSV