Transcript: Mouse NM_001164493.1

Mus musculus kelch-like 29 (Klhl29), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Klhl29 (208439)
Length:
7048
CDS:
735..3362

Additional Resources:

NCBI RefSeq record:
NM_001164493.1
NBCI Gene record:
Klhl29 (208439)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164493.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367042 AGGTACGACACTATCACTAAC pLKO_005 2838 CDS 100% 10.800 15.120 N Klhl29 n/a
2 TRCN0000377180 GCCACAATAGTCTCGTCTATG pLKO_005 2758 CDS 100% 10.800 15.120 N Klhl29 n/a
3 TRCN0000367043 TGCGCTAACATTTCGAATATT pLKO_005 3480 3UTR 100% 15.000 12.000 N Klhl29 n/a
4 TRCN0000376231 ACGCAGAGCGAAAGCATTTAC pLKO_005 1700 CDS 100% 13.200 9.240 N Klhl29 n/a
5 TRCN0000377232 GACACGGCTGTGTTGTGATAA pLKO_005 3319 CDS 100% 13.200 9.240 N Klhl29 n/a
6 TRCN0000371023 AGAGCAAGCTTGATCCCTAAA pLKO_005 3704 3UTR 100% 10.800 7.560 N KLHL29 n/a
7 TRCN0000371069 TTTCAAGGACCTGATTCAAAG pLKO_005 1793 CDS 100% 10.800 7.560 N KLHL29 n/a
8 TRCN0000376264 TTTCAAGGACCTGATTCAAAG pLKO_005 1793 CDS 100% 10.800 7.560 N Klhl29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164493.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13040 pDONR223 100% 52.7% 56.1% None (many diffs) n/a
2 ccsbBroad304_13040 pLX_304 0% 52.7% 56.1% V5 (many diffs) n/a
3 TRCN0000467139 CTGAATGACTCAAGCGAATCGATC pLX_317 30.2% 52.7% 56.1% V5 (many diffs) n/a
Download CSV