Transcript: Human NR_028496.1

Homo sapiens oligosaccharyltransferase complex subunit pseudogene 1 (OSTCP1), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
OSTCP1 (202459)
Length:
1195
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028496.1
NBCI Gene record:
OSTCP1 (202459)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150255 GTTTGTGTCCTATTGAGCTTT pLKO.1 517 3UTR 100% 4.950 3.465 N OSTCP1 n/a
2 TRCN0000146931 CCTGTTTACAATAGGAGGTTT pLKO.1 417 3UTR 100% 4.950 2.970 N OSTCP1 n/a
3 TRCN0000149664 GTTTCATATTCCTGGACCGAT pLKO.1 440 3UTR 100% 2.640 1.584 N OSTCP1 n/a
4 TRCN0000128498 GCTCCTGTCAATGAAGTTTAA pLKO.1 661 3UTR 100% 13.200 6.600 Y OSTCP1 n/a
5 TRCN0000131178 GCATCCAGCTTCCTGTTTACA pLKO.1 406 3UTR 100% 5.625 2.813 Y OSTCP1 n/a
6 TRCN0000128594 GAATGCACCAAATATCCCAAA pLKO.1 462 3UTR 100% 4.050 2.025 Y OSTCP1 n/a
7 TRCN0000134376 GATGTTATTGTTGAACCTCCA pLKO.1 292 3UTR 100% 2.160 1.080 Y OSTC n/a
8 TRCN0000146700 GATGTTATTGTTGAACCTCCA pLKO.1 292 3UTR 100% 2.160 1.080 Y OSTCP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028496.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03865 pDONR223 100% 34.4% None (many diffs) n/a
2 ccsbBroad304_03865 pLX_304 0% 34.4% V5 (many diffs) n/a
3 TRCN0000466811 CACCATCTTCCTCTACTAGCAACA pLX_317 98.7% 34.4% V5 (many diffs) n/a
4 ccsbBroadEn_10576 pDONR223 100% 29.7% None 1_231del;370T>A;589_1195del n/a
5 ccsbBroad304_10576 pLX_304 0% 29.7% V5 1_231del;370T>A;589_1195del n/a
Download CSV