Transcript: Human NM_005769.2

Homo sapiens carbohydrate sulfotransferase 4 (CHST4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CHST4 (10164)
Length:
2145
CDS:
212..1372

Additional Resources:

NCBI RefSeq record:
NM_005769.2
NBCI Gene record:
CHST4 (10164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034836 GACCACGCTTTCCACACAAAT pLKO.1 1160 CDS 100% 13.200 18.480 N CHST4 n/a
2 TRCN0000430817 CAAAGGGAGATCTCATGATTG pLKO_005 861 CDS 100% 10.800 15.120 N CHST4 n/a
3 TRCN0000435874 TGTGCGACATGAGCGTCTTTG pLKO_005 519 CDS 100% 10.800 15.120 N CHST4 n/a
4 TRCN0000034837 GATGGCCATCTTGGCTCTATT pLKO.1 259 CDS 100% 13.200 9.240 N CHST4 n/a
5 TRCN0000434631 TTTCCACAGAGATGCAAATTC pLKO_005 1773 3UTR 100% 13.200 9.240 N CHST4 n/a
6 TRCN0000034834 GCTGGTCTTTGCCCTATGAAA pLKO.1 1215 CDS 100% 5.625 3.938 N CHST4 n/a
7 TRCN0000034835 TGTGACATCATCCCACAAGAT pLKO.1 623 CDS 100% 4.950 3.465 N CHST4 n/a
8 TRCN0000034838 TGCCATGAATTTGCTGGGCTA pLKO.1 1267 CDS 100% 2.160 1.512 N CHST4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11462 pDONR223 100% 95.8% 95.8% None 1_48del n/a
2 ccsbBroad304_11462 pLX_304 0% 95.8% 95.8% V5 1_48del n/a
3 TRCN0000479935 CTAACCTAAAAATTACGGTACTTT pLX_317 39.2% 95.8% 95.8% V5 1_48del n/a
Download CSV